ID: 1024352207

View in Genome Browser
Species Human (GRCh38)
Location 7:48377976-48377998
Sequence CCTTAGATGCTGATGGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024352207_1024352213 -8 Left 1024352207 7:48377976-48377998 CCCTCAACCATCAGCATCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1024352213 7:48377991-48378013 ATCTAAGGCTAGAGGCTCTTGGG 0: 1
1: 0
2: 0
3: 7
4: 108
1024352207_1024352214 -7 Left 1024352207 7:48377976-48377998 CCCTCAACCATCAGCATCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1024352214 7:48377992-48378014 TCTAAGGCTAGAGGCTCTTGGGG No data
1024352207_1024352215 14 Left 1024352207 7:48377976-48377998 CCCTCAACCATCAGCATCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1024352215 7:48378013-48378035 GGCAATATTTTTCTACATTATGG No data
1024352207_1024352216 25 Left 1024352207 7:48377976-48377998 CCCTCAACCATCAGCATCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1024352216 7:48378024-48378046 TCTACATTATGGTAAAGCAAAGG No data
1024352207_1024352212 -9 Left 1024352207 7:48377976-48377998 CCCTCAACCATCAGCATCTAAGG 0: 1
1: 0
2: 0
3: 14
4: 186
Right 1024352212 7:48377990-48378012 CATCTAAGGCTAGAGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024352207 Original CRISPR CCTTAGATGCTGATGGTTGA GGG (reversed) Intronic
901448613 1:9323044-9323066 TCTTTGATGCTGGTGGTGGACGG + Intronic
902401598 1:16160733-16160755 CCTTAGATGCTCACATTTGATGG + Intergenic
904346311 1:29872754-29872776 AGTTAGATCCTGTTGGTTGATGG - Intergenic
906931304 1:50172167-50172189 CCTGACATCCTTATGGTTGATGG - Intronic
907102851 1:51852886-51852908 CCTCAGATTATGATGATTGAAGG - Intronic
908679821 1:66648225-66648247 CCTGAGGTGCTGACAGTTGAAGG + Intronic
910509744 1:87990568-87990590 CTTTACATGCTGATGGTGCAGGG + Intergenic
911117359 1:94259637-94259659 CCCTAGTTTCTGATGGTTGCCGG - Intronic
915744035 1:158142417-158142439 CCTGAAAAGCTGATGGATGAGGG - Intergenic
915914182 1:159931340-159931362 CCTGGGATGATGATGGGTGAAGG - Intronic
916865379 1:168850765-168850787 CCTTAAATGCTGATTTCTGACGG - Intergenic
916923886 1:169497592-169497614 TCTTAGATGTTTATGGTTAAGGG + Intergenic
917312721 1:173693552-173693574 AATGAGATGTTGATGGTTGATGG - Intergenic
918236313 1:182583729-182583751 ACTTGGATACTGATGTTTGAGGG - Intronic
918414115 1:184289333-184289355 CCTTAGATGGTGAAGGCTCAGGG - Intergenic
918909659 1:190550194-190550216 CCTTACATGTTTATGGTTGTTGG - Intergenic
919127990 1:193419423-193419445 CCTATGATGCTGATGGTTCAGGG + Intergenic
919723633 1:200866909-200866931 CCTTAGATGTTGAGGGTGCAGGG + Intergenic
920752028 1:208687561-208687583 CCCTAGATACTGATGGGAGAAGG - Intergenic
921140497 1:212300944-212300966 CCGTTTATGCTGATGGTAGAAGG + Intronic
921400078 1:214712256-214712278 CATTAGACGCTGTTGGTTGATGG + Intergenic
921562512 1:216675558-216675580 CATTAGATGATGATGGTCTATGG + Intronic
1066320322 10:34296696-34296718 CAGTACATGCTGATGGTGGATGG + Intronic
1068706302 10:60079725-60079747 CCTTAGTTCCTGCTGGTGGAGGG + Intronic
1069002807 10:63284492-63284514 CTGCAGATGCTGCTGGTTGAGGG - Intronic
1069071272 10:63992572-63992594 CCATGGAGGCAGATGGTTGAGGG + Intergenic
1069630456 10:69894295-69894317 CATGAGATGCTGGTGGTTGGAGG + Intronic
1071038940 10:81283021-81283043 CCCTAGATGTTTATGGTTAAGGG - Intergenic
1073364551 10:102927813-102927835 GCTTAGATGTTGATGGATAATGG + Intronic
1075013402 10:118893541-118893563 CTTCAGGTGCTGATGGTTGAAGG + Intergenic
1075293368 10:121250540-121250562 CCTGAGATACTCATGGTGGAAGG + Intergenic
1076209640 10:128629919-128629941 CCTTGGATGCTGATAATTGAAGG - Intergenic
1079663696 11:23075674-23075696 ACTTAGAGTCTGATGTTTGAGGG - Intergenic
1081548768 11:44093172-44093194 TCTTAGTAGCTGGTGGTTGAAGG - Intergenic
1081748285 11:45488273-45488295 CCTTCAGTGCTGAGGGTTGAGGG + Intergenic
1081850067 11:46269566-46269588 CCATGCATGCTGATGTTTGAAGG + Intergenic
1081938768 11:46922881-46922903 ACTTACAGTCTGATGGTTGAAGG + Intergenic
1085181791 11:74542639-74542661 CCTTAAATGGTGAAGGTTCAGGG - Intronic
1087380630 11:97400385-97400407 CCTTTGAAGCAGATGGTGGAAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1090564570 11:127974450-127974472 AATTAGATCCTGTTGGTTGATGG - Intergenic
1093180582 12:15962670-15962692 CTTTAAATGCTGATGTTTGGGGG + Intronic
1093243429 12:16706432-16706454 CATTATAAGCTGATGGTTGCAGG - Intergenic
1095941176 12:47728034-47728056 CCTCTGGTGCTGAGGGTTGAGGG + Intergenic
1096586431 12:52624396-52624418 AATTAGATCCTGTTGGTTGATGG - Intergenic
1097754957 12:63398886-63398908 CCTTAAATGGTGATGGCTCAGGG - Intergenic
1099640280 12:85277541-85277563 CTTTTGATGGTAATGGTTGAAGG - Intergenic
1100416507 12:94382873-94382895 ATTTAGGTTCTGATGGTTGATGG + Intronic
1102557200 12:113734963-113734985 ACGTGGATGCTGCTGGTTGACGG + Intergenic
1102679297 12:114679862-114679884 CCTTAGATGGTGAGGGTGGGGGG - Intronic
1103594162 12:122013548-122013570 CCTTAGGTGTGGATGGTGGATGG - Intergenic
1106911277 13:34465867-34465889 CCTTGGAGTCTGATGTTTGAAGG - Intergenic
1108954103 13:56129604-56129626 CCTTAAATGATGAAGGATGATGG - Intergenic
1112960655 13:105121264-105121286 TCTTAGCTGCTGGTGGTTGCTGG - Intergenic
1113475744 13:110579733-110579755 CGTCAGATCCTGTTGGTTGATGG + Intergenic
1113798339 13:113073318-113073340 AGTTAGATCCTGTTGGTTGATGG + Intronic
1119614972 14:76093000-76093022 CCTGAGATGGTGAGGGCTGATGG - Intergenic
1133662490 16:7932871-7932893 ACTTAGAGTCTGATGTTTGAGGG + Intergenic
1135148719 16:19986547-19986569 CCAGAGATGCTGATGTCTGAGGG + Intergenic
1135766706 16:25183789-25183811 GCTTTGATGTTGATGGTTGCTGG - Intergenic
1141760260 16:86023900-86023922 CATTAGATCCTGTTGGTTGATGG + Intergenic
1145826323 17:27879788-27879810 CCTTAGATGCTGGTATTAGAAGG - Intronic
1147524499 17:41208685-41208707 AATTAGATCCTGTTGGTTGATGG + Intronic
1150023537 17:61646892-61646914 CCTTAGTTGATGATGTTTGCAGG - Intergenic
1150569605 17:66374362-66374384 CCTAAGAGACTGTTGGTTGAGGG + Intronic
1151477096 17:74350384-74350406 CCTCAGCTGCCGATGGGTGAGGG - Exonic
1152350811 17:79783130-79783152 CCTTGAAAGCTGATGGTGGACGG + Intronic
1155534702 18:26805261-26805283 CCTTAGATTCTGCTGGGTGGAGG - Intergenic
1155582608 18:27326828-27326850 AATTAGATCCTGTTGGTTGATGG - Intergenic
1156321267 18:36025918-36025940 CCTCAGATGATGATAGTTGGTGG - Intronic
1159832408 18:73293549-73293571 CCTTAGATGACGCTGGTTGTGGG + Intergenic
1160811318 19:1014128-1014150 CCGTAGATGCTGGTCGCTGAAGG - Intronic
1164962556 19:32446848-32446870 CATTAGATTCTGTCGGTTGAAGG - Intronic
925803513 2:7625981-7626003 ACTTACATGCTGATGATTGCAGG + Intergenic
928415972 2:31092031-31092053 ACTTAGAGTCTGATGTTTGAGGG - Intronic
931971816 2:67595294-67595316 CATTAGATCCTGTTGTTTGATGG + Intergenic
932429166 2:71663649-71663671 CCTTTGATGCACATGGTAGATGG + Intronic
935701202 2:105813515-105813537 TCTCAGATGCTGATAGTTGGAGG + Intronic
936134678 2:109879736-109879758 CCCTAGATGTTTATGGTTAAGGG + Intergenic
936210019 2:110491749-110491771 CCCTAGATGTTTATGGTTAAGGG - Intergenic
936340597 2:111628847-111628869 GATTAGATCCTGTTGGTTGACGG - Intergenic
936429212 2:112447221-112447243 CCCTAGATGTTTATGGTTAAGGG - Intergenic
939933052 2:148256756-148256778 CCTTAAATGCTGAAGGCTCAGGG + Intronic
940756653 2:157690574-157690596 CCTTAGATGGGCATGGTTCATGG + Intergenic
942493325 2:176511638-176511660 ACTTAGAGTCTGATGTTTGAGGG + Intergenic
943636265 2:190310109-190310131 ACTTGGAAGCTGATGTTTGAAGG - Intronic
945320982 2:208423598-208423620 TATTAGATCCTGTTGGTTGATGG + Intronic
945863349 2:215148923-215148945 CCTTAGTTCCTGATGGTAAATGG - Intergenic
947877205 2:233475501-233475523 CCTTAGCTGCTTTTGGTTGCCGG - Exonic
948422039 2:237865595-237865617 CCTTGGATTCTGAGGGGTGATGG + Intronic
1168933879 20:1646465-1646487 CCATAGATGCTGCTGAGTGAAGG + Intronic
1169053805 20:2603169-2603191 CCTTACCTGCTGATAGCTGATGG - Intronic
1169320622 20:4630462-4630484 TGTTAGATCCTGTTGGTTGAAGG - Intergenic
1171174128 20:23038523-23038545 ACTTAGTTGATGAAGGTTGAAGG + Intergenic
1175396898 20:58670953-58670975 CTTTAGATCCTGCTGGTTTAGGG + Intronic
1176970301 21:15257394-15257416 TCTCATTTGCTGATGGTTGAGGG + Intergenic
1176997728 21:15576779-15576801 ACTTGGAGGCTGATGTTTGAGGG - Intergenic
1177296848 21:19187044-19187066 ACTTGGAGGCTGATGTTTGAGGG + Intergenic
1177450397 21:21258562-21258584 CCTTAGGTCCTGAGGGTGGAGGG - Intronic
1177837929 21:26205884-26205906 CATAAGATGTTTATGGTTGAAGG + Intergenic
1177856444 21:26405683-26405705 CCTGAGAAGCTGATGGCTGAAGG - Intergenic
1178121968 21:29478245-29478267 ACCTAGAGGCTGATGTTTGAGGG + Intronic
1178734458 21:35136522-35136544 CCAGAGACGCTGATGGATGAGGG - Intronic
1180987763 22:19915436-19915458 CCTGCCAGGCTGATGGTTGATGG - Intronic
1181028849 22:20140510-20140532 CCTTAGAAGCTGATACTTGCGGG - Intronic
1182946263 22:34325264-34325286 CTTTAAATGGTGATGGTTCAGGG - Intergenic
1182956306 22:34429863-34429885 CCTTAGAAGCTTATGGTTTGGGG - Intergenic
1184941630 22:47770947-47770969 AATTAGATGCAGAGGGTTGATGG - Intergenic
949637255 3:5996396-5996418 ACTTGGATTCTGATGTTTGAGGG + Intergenic
949638347 3:6008845-6008867 ACTTAGAGTCTGATGTTTGAGGG - Intergenic
949899130 3:8795242-8795264 ACTTGGATGGTGATGGGTGAAGG + Intronic
950784084 3:15418526-15418548 CCTTAGATGCTGTTGTTATAGGG - Intronic
951005360 3:17609646-17609668 CCTCAGAGGATGATAGTTGAAGG - Intronic
952748587 3:36805008-36805030 CCTGAGAGGCTTGTGGTTGAGGG - Intergenic
953309958 3:41867266-41867288 CTTTTGATGCTGCTGGTTTAGGG - Intronic
957117915 3:76050279-76050301 ACTTAGAGTCTGATGTTTGAGGG - Intronic
957640894 3:82851954-82851976 ACTTATATGCGGATGGTTGTTGG + Intergenic
957951418 3:87132092-87132114 ACTTAGAGTCTGATGTTTGAGGG + Intergenic
958468200 3:94484450-94484472 CCTAAGATGCTGATGCTTTCAGG + Intergenic
961733412 3:128984461-128984483 ACTTGGAGGCTGATGTTTGAGGG - Intronic
963786535 3:149540248-149540270 CCTTAAATGCTGATCCTTGGAGG - Intronic
965034684 3:163423313-163423335 ACTTAGAGTCTGATGATTGAGGG + Intergenic
965818270 3:172659112-172659134 CAATAGAGGGTGATGGTTGAGGG - Intronic
965995768 3:174880900-174880922 TCTTAGATTCTGGTGGCTGATGG + Intronic
966283167 3:178259106-178259128 ACTTAGATCCTGTTGTTTGATGG - Intergenic
969922911 4:10557527-10557549 CCCTAGATGCAGAGGGATGAGGG - Intronic
970012504 4:11474878-11474900 CTTTAGATTCTGATGTTTGCAGG - Intergenic
972771692 4:42203352-42203374 CCTTAGGTGTTGCTGGTTGGAGG - Intergenic
973698157 4:53511444-53511466 TCTCAGATGGTGATGGGTGATGG + Intronic
974564365 4:63564713-63564735 ACTTGGATTCTGATGTTTGAGGG - Intergenic
979703525 4:123694091-123694113 CCTTGGATACTGAGGGATGAGGG + Intergenic
979816837 4:125117645-125117667 CCCTGGGTGCTGATGGTTGGTGG + Intergenic
982606386 4:157521662-157521684 ACGTAGAATCTGATGGTTGAGGG + Intergenic
983074129 4:163304180-163304202 CCCTAGATGGTGAAGGGTGAAGG + Intergenic
984876129 4:184369342-184369364 ACTTAGCAGCTGAGGGTTGAAGG - Intergenic
987535795 5:19185408-19185430 TCTTAGATGCTGTTTGTTGCAGG - Intergenic
987915301 5:24205159-24205181 ACTTAGAGTCTGATGGTTGAGGG - Intergenic
989819619 5:45780168-45780190 CCTTAGCTCCTGATTATTGATGG + Intergenic
990865514 5:60375676-60375698 CCAAAAATGCTCATGGTTGAGGG - Intronic
991452479 5:66767736-66767758 ACTTAGAGTCTGATGTTTGAGGG + Intronic
992899311 5:81277443-81277465 CCTCAGATGCTGCTGCCTGATGG - Intergenic
995741614 5:115361723-115361745 TCTTATATGGTGATGGTTCATGG + Intergenic
998532698 5:142900403-142900425 CCTTAGATTCTCATGGGTGGTGG - Intronic
1001672780 5:173488049-173488071 CTTTAGGTTCTGATGGATGAGGG - Intergenic
1002568678 5:180128187-180128209 CCTTTGAGACTGAGGGTTGATGG - Intronic
1003826335 6:9956357-9956379 GCTTATAGGCTGATGGTTGATGG + Intronic
1005692937 6:28324419-28324441 CCTCAGATGCTGCTGGTTCATGG - Intergenic
1010581144 6:77597206-77597228 ACTTAGAGTCTGATGTTTGAGGG + Intergenic
1011505519 6:88038055-88038077 AATTAGATGCTGCTGGTTGATGG - Intergenic
1012260406 6:97081579-97081601 CGTTTGATGCTGAGAGTTGAAGG - Intronic
1013419437 6:109952712-109952734 CCTGAGAGGCAGATGGTTGGAGG - Intergenic
1013695413 6:112697316-112697338 ACTTAGAGTCTGATGTTTGAGGG + Intergenic
1014013299 6:116501266-116501288 CCTGAGATGCTGAAGCTTGGCGG + Intronic
1015383592 6:132597669-132597691 CCTTTGTTGCTGATGCTTGGGGG - Intergenic
1016562920 6:145417367-145417389 CCTGAGATGCTAATGGGTCAAGG - Intergenic
1019380613 7:720492-720514 AATTAGATCCTGTTGGTTGATGG + Intronic
1023025020 7:36042335-36042357 CCTGAGATGGTGAGGGGTGATGG + Intergenic
1023640586 7:42253194-42253216 CCCAAGATGCTGATGGTTGTGGG - Intergenic
1023969551 7:44980841-44980863 CTTTAGCTGCTGCTGGTTGCTGG + Intergenic
1024352207 7:48377976-48377998 CCTTAGATGCTGATGGTTGAGGG - Intronic
1030328852 7:108251607-108251629 CCTTTGAGGCTGCTGGTTGTTGG + Intronic
1033018487 7:137697009-137697031 CCCTAGCTGCTGGTGGTTGCTGG - Intronic
1033123867 7:138690039-138690061 CCCTAGCTGCTGGTGGTTGCTGG - Intronic
1035278666 7:157763690-157763712 CCTTGGATGCTGAGGGCTGGTGG + Intronic
1039034079 8:33340925-33340947 GATTAGATTCTGTTGGTTGATGG - Intergenic
1039116025 8:34092008-34092030 CTCTAGATGTTGATGGTTAAAGG + Intergenic
1039778739 8:40762722-40762744 TCATAGATGCTGGTGGTTGCTGG - Intronic
1039839743 8:41285244-41285266 GCTCAGATGCTGACGGCTGAGGG - Intronic
1040971148 8:53138737-53138759 GTTTAGATGCTGCTGCTTGAGGG - Intergenic
1042208318 8:66351327-66351349 CCCTAGATGTTTATGGTTAAGGG + Intergenic
1042459817 8:69050980-69051002 ATTTAGATTCTGTTGGTTGATGG - Intergenic
1044044129 8:87409295-87409317 CTCTAGATGCTGAGGCTTGAGGG - Intronic
1044167667 8:89007155-89007177 CCTTGGAATCTGATGTTTGAGGG - Intergenic
1044473234 8:92596968-92596990 CCCTGGATACTGATGGTTGACGG - Intergenic
1045417772 8:101984095-101984117 CCTTAGGTGCTCATGGTTTGTGG - Intronic
1046418080 8:113941264-113941286 ACTTGGATTCTGATGTTTGAGGG + Intergenic
1048439858 8:134451865-134451887 CCTTATATGATGATAGATGAAGG - Intergenic
1048905413 8:139083136-139083158 CCTTAAATGCTTATGGCTAAGGG - Intergenic
1049263919 8:141655205-141655227 GATTAGATCCTGTTGGTTGATGG + Intergenic
1050231817 9:3534092-3534114 CCTTAGACGCTGATGGTTTCTGG - Intergenic
1051008515 9:12380766-12380788 ACTTAGAGTCTGATGTTTGAGGG + Intergenic
1051965998 9:22830775-22830797 ACTTAGAGTCTGATGTTTGAGGG - Intergenic
1052630627 9:31034110-31034132 CCTTAGAAGCTCATGGTTCTTGG - Intergenic
1055692645 9:78849354-78849376 AATTAGATTCTGTTGGTTGAAGG + Intergenic
1059427662 9:114231214-114231236 CCTTAGATGATGCTGGGGGAAGG + Intronic
1060202730 9:121661135-121661157 CCTTGGATGCTGATGCTGCAGGG + Intronic
1188928396 X:36074790-36074812 CATCAGAGGCTGAAGGTTGAGGG - Intronic
1189043470 X:37567475-37567497 CATTAGATACTAATGGTTGGTGG + Intronic
1189709582 X:43795625-43795647 CCTTTGATGCCAATGATTGATGG - Intronic
1190453860 X:50606861-50606883 CCTTTGATGCTGGTGGTTGTGGG + Intronic
1190520583 X:51275939-51275961 ACTTAGAGTCTGATGTTTGAGGG + Intergenic
1191955444 X:66638692-66638714 CCCTAGATGCTCAAGGTTGTTGG + Intronic
1192248468 X:69391885-69391907 CACTAGAGACTGATGGTTGATGG + Intergenic
1193021806 X:76800047-76800069 CCTTAAATGATGATGGCTCATGG - Intergenic
1195303941 X:103560400-103560422 AATTAGATGCAGTTGGTTGATGG - Intergenic
1196529123 X:116762874-116762896 AGTTAGATGCTGTTGGTTCATGG - Intergenic
1196585616 X:117423931-117423953 CCTTGGAGTCTGATGTTTGAAGG - Intergenic
1197037616 X:121895445-121895467 ACTTAGAGTCTGATGTTTGAGGG - Intergenic
1197187424 X:123603461-123603483 CATTAGATGCTGATTCTGGATGG + Intronic
1197578163 X:128248061-128248083 AATTAGATCCTGTTGGTTGATGG - Intergenic
1201531014 Y:14989778-14989800 CCATAGATGGAGATGGTAGAGGG - Intergenic