ID: 1024355920

View in Genome Browser
Species Human (GRCh38)
Location 7:48413225-48413247
Sequence AGACAGAAGCAGAAAGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2155
Summary {0: 1, 1: 0, 2: 17, 3: 242, 4: 1895}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024355920_1024355932 20 Left 1024355920 7:48413225-48413247 CCCTCCTCTTTCTGCTTCTGTCT 0: 1
1: 0
2: 17
3: 242
4: 1895
Right 1024355932 7:48413268-48413290 TGGGTATCCGTGATGTGAGAGGG No data
1024355920_1024355931 19 Left 1024355920 7:48413225-48413247 CCCTCCTCTTTCTGCTTCTGTCT 0: 1
1: 0
2: 17
3: 242
4: 1895
Right 1024355931 7:48413267-48413289 CTGGGTATCCGTGATGTGAGAGG 0: 1
1: 0
2: 0
3: 3
4: 99
1024355920_1024355926 0 Left 1024355920 7:48413225-48413247 CCCTCCTCTTTCTGCTTCTGTCT 0: 1
1: 0
2: 17
3: 242
4: 1895
Right 1024355926 7:48413248-48413270 GGGAGTCTCTGGCCCCATGCTGG 0: 1
1: 0
2: 0
3: 33
4: 244
1024355920_1024355934 30 Left 1024355920 7:48413225-48413247 CCCTCCTCTTTCTGCTTCTGTCT 0: 1
1: 0
2: 17
3: 242
4: 1895
Right 1024355934 7:48413278-48413300 TGATGTGAGAGGGTTTAGCACGG 0: 1
1: 0
2: 0
3: 7
4: 169
1024355920_1024355927 1 Left 1024355920 7:48413225-48413247 CCCTCCTCTTTCTGCTTCTGTCT 0: 1
1: 0
2: 17
3: 242
4: 1895
Right 1024355927 7:48413249-48413271 GGAGTCTCTGGCCCCATGCTGGG 0: 1
1: 0
2: 4
3: 15
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024355920 Original CRISPR AGACAGAAGCAGAAAGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr