ID: 1024356027

View in Genome Browser
Species Human (GRCh38)
Location 7:48414204-48414226
Sequence CATGAACGGCGCCTCTGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024356025_1024356027 2 Left 1024356025 7:48414179-48414201 CCTATTTTCATTCTTCAAGTCTT 0: 1
1: 0
2: 1
3: 53
4: 573
Right 1024356027 7:48414204-48414226 CATGAACGGCGCCTCTGCAGCGG 0: 1
1: 0
2: 0
3: 2
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024356027 Original CRISPR CATGAACGGCGCCTCTGCAG CGG Intronic
904616755 1:31754137-31754159 CATCATCAGAGCCTCTGCAGAGG - Intronic
904893135 1:33794235-33794257 TATGCAGGGCCCCTCTGCAGTGG + Intronic
905299742 1:36978775-36978797 CATGCAAGGAGCCTTTGCAGAGG + Intronic
909107416 1:71430076-71430098 CATGAGCAGGGACTCTGCAGTGG - Intronic
920572533 1:207028477-207028499 CATGAACAGGGCACCTGCAGTGG + Intronic
923055414 1:230422969-230422991 CATGCACAGCGACTCTGCAAAGG + Intronic
1074126259 10:110530792-110530814 CATGAAAGGAGACTCTGCACTGG - Intergenic
1074843381 10:117375829-117375851 GATGAGCGACGCCGCTGCAGAGG - Intergenic
1076852168 10:133098591-133098613 CATGAGCAGAGGCTCTGCAGGGG - Intronic
1077100376 11:819844-819866 CATCTACGGCGCCTCGGCCGGGG + Exonic
1078270611 11:9791341-9791363 CATGAAGGGTGTCTCAGCAGTGG + Intronic
1084887297 11:72219103-72219125 CATGAATGGCCCCTGTGGAGGGG + Intronic
1087759040 11:102086166-102086188 CATGGAAGCCTCCTCTGCAGGGG + Intergenic
1090886636 11:130882740-130882762 CCTGATCGGCTTCTCTGCAGGGG + Intronic
1104761052 12:131297765-131297787 AAGGAACAGCCCCTCTGCAGCGG + Intergenic
1104818725 12:131663027-131663049 AAGGAACAGCCCCTCTGCAGCGG - Intergenic
1105760139 13:23506664-23506686 CAGGCACAGCGCCTCAGCAGAGG - Intergenic
1112643756 13:101306343-101306365 CATGAAATGGGCATCTGCAGAGG - Intronic
1117546933 14:56801064-56801086 CTTGAACTCCACCTCTGCAGGGG - Exonic
1120614132 14:86681239-86681261 CAGGAAGGGAGCATCTGCAGGGG - Intergenic
1122322861 14:100866139-100866161 CATGAGCCCGGCCTCTGCAGAGG - Intergenic
1129745980 15:78021507-78021529 CATGCAGGTCTCCTCTGCAGTGG - Intronic
1130517150 15:84634103-84634125 CCTGGACGGCGGCGCTGCAGCGG - Intergenic
1133031458 16:3013198-3013220 CATGAAAGGCGCCTCTTGAAAGG - Exonic
1134662068 16:15991763-15991785 CATACACGCCGACTCTGCAGTGG + Intronic
1134822849 16:17260579-17260601 CCTGAACAGCGGATCTGCAGGGG + Intronic
1138119850 16:54391197-54391219 CATGAAAGAGGCCTCTGGAGAGG + Intergenic
1143120055 17:4600761-4600783 CCTGCACTGGGCCTCTGCAGAGG - Intronic
1146661876 17:34670298-34670320 CATGAAAGGCCTCTCTGAAGTGG + Intergenic
1147323870 17:39661177-39661199 CAGGAACGCAGCCTCAGCAGGGG - Intronic
1158259091 18:55588072-55588094 CATGAACGCCGCCTCGGCGCCGG - Intronic
1160506624 18:79430813-79430835 AATGAAGGGCCCCTCTGCAGTGG - Intronic
1160522006 18:79513227-79513249 CGGGGACGGCGTCTCTGCAGCGG - Intronic
1160592004 18:79950399-79950421 CAGGAACGGCTCCTCTCCACAGG + Intronic
1162100192 19:8334555-8334577 CAAGGAGGGCGCCTCTGCCGGGG + Exonic
1163332976 19:16653152-16653174 TATGCCCGGCACCTCTGCAGGGG - Intronic
927864879 2:26581958-26581980 CATGCACGGCCTCCCTGCAGTGG - Intronic
927948952 2:27154649-27154671 CTTGAACCACGTCTCTGCAGAGG + Exonic
929267247 2:39931654-39931676 GATGAACGGAGCCTCTGATGGGG + Intergenic
938716653 2:134027809-134027831 TAGGAAAGGCGCCCCTGCAGGGG - Intergenic
939493226 2:142900795-142900817 CATCAAAGGCACCTCTCCAGAGG - Intronic
1170665949 20:18385971-18385993 CCTGAAAGGCTCCTATGCAGAGG + Intronic
1171504422 20:25622264-25622286 CATGCACGGGGCATGTGCAGTGG + Intronic
1172236050 20:33375476-33375498 CAAGAAAGGCTCCTTTGCAGTGG + Intronic
1175544832 20:59771482-59771504 CAGGAAAGGCTGCTCTGCAGAGG - Intronic
1175733414 20:61369806-61369828 CTCAAATGGCGCCTCTGCAGGGG - Intronic
952871618 3:37906009-37906031 AAGGTACTGCGCCTCTGCAGGGG - Intronic
956784466 3:72630848-72630870 CATGAAGGATGCTTCTGCAGAGG - Intergenic
956787913 3:72657791-72657813 CCTGAACCGCTCCACTGCAGGGG - Intergenic
962008220 3:131369305-131369327 CATGGACGATGCCTCTTCAGGGG - Intergenic
968953136 4:3704894-3704916 CACGAGAGGCGCCTCAGCAGAGG - Intergenic
992390659 5:76327907-76327929 CAAGAACGGTCCTTCTGCAGGGG - Exonic
998336126 5:141374079-141374101 CAGTAATGGCGCCTCCGCAGAGG + Exonic
1011745878 6:90407307-90407329 TAGGAAAGGCCCCTCTGCAGGGG - Intergenic
1011831868 6:91383992-91384014 CATAAATGGCACCTCTCCAGTGG + Intergenic
1018443451 6:163834364-163834386 CATGCACGGCTCCTGTGGAGGGG - Intergenic
1019289622 7:243773-243795 CCTGGGCGCCGCCTCTGCAGTGG + Intronic
1019434575 7:1015416-1015438 CATGAACCCAGCCTCTGCAGGGG - Intronic
1024356027 7:48414204-48414226 CATGAACGGCGCCTCTGCAGCGG + Intronic
1024375922 7:48637886-48637908 TATGAACTGGGCATCTGCAGGGG + Intronic
1027829661 7:83162350-83162372 CATGGAAGGCGACTCCGCAGCGG + Exonic
1031673015 7:124574868-124574890 CATGTACAGAGCCTCTGCTGAGG - Intergenic
1051687032 9:19668583-19668605 GATGGATGGCGCCACTGCAGAGG - Intronic
1059457087 9:114406505-114406527 CCTGAAAAGCCCCTCTGCAGAGG - Exonic
1190441365 X:50478028-50478050 CATGAAAGGCTTCTCTGAAGAGG + Intergenic
1192340952 X:70262956-70262978 AATGAACCTGGCCTCTGCAGAGG + Intergenic