ID: 1024356896

View in Genome Browser
Species Human (GRCh38)
Location 7:48422813-48422835
Sequence CATCAAAGGGGGATCGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024356888_1024356896 17 Left 1024356888 7:48422773-48422795 CCCAAATTATCTGGGTGGACTTG 0: 1
1: 0
2: 2
3: 19
4: 242
Right 1024356896 7:48422813-48422835 CATCAAAGGGGGATCGAGGAAGG No data
1024356889_1024356896 16 Left 1024356889 7:48422774-48422796 CCAAATTATCTGGGTGGACTTGA 0: 1
1: 0
2: 3
3: 14
4: 118
Right 1024356896 7:48422813-48422835 CATCAAAGGGGGATCGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024356896 Original CRISPR CATCAAAGGGGGATCGAGGA AGG Intronic
No off target data available for this crispr