ID: 1024357402

View in Genome Browser
Species Human (GRCh38)
Location 7:48428236-48428258
Sequence ATGCAAATCCATTACCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024357402_1024357407 1 Left 1024357402 7:48428236-48428258 CCCTCCTGGTAATGGATTTGCAT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1024357407 7:48428260-48428282 GTTTAACAAAGCCCCGGATGTGG No data
1024357402_1024357406 -5 Left 1024357402 7:48428236-48428258 CCCTCCTGGTAATGGATTTGCAT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1024357406 7:48428254-48428276 TGCATGGTTTAACAAAGCCCCGG No data
1024357402_1024357408 2 Left 1024357402 7:48428236-48428258 CCCTCCTGGTAATGGATTTGCAT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1024357408 7:48428261-48428283 TTTAACAAAGCCCCGGATGTGGG 0: 1
1: 0
2: 0
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024357402 Original CRISPR ATGCAAATCCATTACCAGGA GGG (reversed) Intronic
905509682 1:38509178-38509200 ATGCAAATCTATTACCTAAAAGG + Intergenic
906387004 1:45378563-45378585 TGGCAAATCCATTTCCAAGATGG - Intronic
906803597 1:48758828-48758850 ATGCAGATCCTCTTCCAGGAAGG - Intronic
907746660 1:57220342-57220364 ATGTAAAACAATTCCCAGGAGGG + Intronic
907863058 1:58372302-58372324 ATGCAAATCCAAAACCTGGCTGG - Intronic
908281727 1:62545602-62545624 CTCCAAATCCATTATTAGGAAGG - Intronic
910413845 1:86976182-86976204 ATCAAAATCTATTACCATGAGGG - Intronic
912344263 1:108950126-108950148 ATTCAAATTCAATACCAGGTAGG + Intronic
912683559 1:111744165-111744187 TTGTAATTCCAATACCAGGAGGG + Intronic
912790538 1:112645240-112645262 ATGGAAAACCAATACCATGAAGG + Intronic
915819337 1:159005285-159005307 ATGCATGTCCATTACAGGGAGGG + Intronic
918308757 1:183270498-183270520 GTGGAAATGCATTTCCAGGATGG + Intronic
918761773 1:188419588-188419610 ATGAAAAGCCATCACGAGGATGG + Intergenic
920455940 1:206101190-206101212 AGGCACATCCATTACCTGGCAGG - Exonic
921906714 1:220502860-220502882 ATGCTAATCCATTAACAGGCAGG + Intergenic
922986847 1:229872664-229872686 ATCCAAATCCATGACCACTACGG + Intergenic
1063325063 10:5090773-5090795 ATGCCATTCCATTACCATGTAGG - Intronic
1065250707 10:23808928-23808950 AGGCAAATCCGTAACAAGGAAGG + Intronic
1069237989 10:66102482-66102504 ATGCACATGCATTCCCAGGAAGG + Intronic
1069262265 10:66413714-66413736 ATGTAAATCCATTATCCAGAAGG + Intronic
1069681525 10:70288905-70288927 ATGGAAATCAGTTTCCAGGATGG - Intergenic
1070583783 10:77745477-77745499 ATTCAAATGCTTTTCCAGGAAGG - Intergenic
1076090043 10:127677243-127677265 ATTTAAATCCATTACTACGAAGG + Intergenic
1077155648 11:1089748-1089770 ATGCACACCCATCACCTGGATGG - Intergenic
1081270451 11:41076967-41076989 ATGCAAGTCCAAAACCAGGCCGG + Intronic
1086152359 11:83625891-83625913 ATGGAAATCCAGTACCAGCTTGG - Intronic
1086240791 11:84687912-84687934 ATGCAAATAAAATACCAGGTGGG + Intronic
1090456707 11:126856232-126856254 ATACAAACACATAACCAGGATGG + Intronic
1090944180 11:131414783-131414805 ATGCAAGTACATTGACAGGAAGG - Intronic
1091118373 11:133036245-133036267 ATGCCAATTCTTTCCCAGGATGG + Intronic
1093417508 12:18936668-18936690 ATGCAAACACAATATCAGGAAGG + Intergenic
1096706620 12:53425891-53425913 ATGCAGTTCCAGTACCAGCAGGG - Exonic
1099823018 12:87738419-87738441 ATGTTAATCCATTACCATGCAGG - Intergenic
1100505744 12:95218161-95218183 CCGCACATCCATTCCCAGGAAGG - Intronic
1104180889 12:126379484-126379506 ATAGAAAGCCATTACCAGGCAGG - Intergenic
1105006337 12:132723200-132723222 TTCCAAATCCCTGACCAGGACGG + Intergenic
1108286340 13:48912473-48912495 GGGCAAATTCATTACCTGGAAGG - Intergenic
1112555614 13:100465875-100465897 AAGCAAATCCAGTATCAGGACGG - Intronic
1112976704 13:105328793-105328815 ATGCAAAGTAAGTACCAGGATGG - Intergenic
1113165699 13:107439299-107439321 ATACAAATCAATTTCCTGGAAGG + Intronic
1119256740 14:73204738-73204760 ATGGAAATCCATAAACAGGCTGG + Intronic
1119331816 14:73800571-73800593 ATGGAAAACCAGAACCAGGAAGG - Intergenic
1120115297 14:80609506-80609528 GTGCAAATCCATCACCATGTGGG - Intronic
1121062628 14:90929639-90929661 ATGCAAATTCATTGACTGGAAGG + Intronic
1125283387 15:38067433-38067455 GAGAAAATCCATTACAAGGATGG + Intergenic
1131674190 15:94654647-94654669 AAGCAAATCATTTACCATGAAGG + Intergenic
1131706487 15:95001685-95001707 ATGCAAATTCATTGCCTGGTTGG - Intergenic
1133335609 16:5004873-5004895 ATGCTATTCCATTACATGGATGG - Intronic
1134273469 16:12755168-12755190 ATGCAATTCCAATGCCAGAAGGG - Intronic
1140706779 16:77638069-77638091 GTGCATATCCCTTACCAGCAGGG + Intergenic
1141577659 16:84974938-84974960 AGGCAAAACAATTCCCAGGAGGG + Intronic
1145274176 17:21420213-21420235 AGGCAACTCCTTTCCCAGGAGGG + Intergenic
1145312038 17:21706112-21706134 AGGCAACTCCTTTCCCAGGAGGG + Intergenic
1147895982 17:43751675-43751697 CTGCAATCCCATTACCACGAGGG - Intergenic
1149385405 17:56138283-56138305 ATTCAAATCCATTTTCTGGATGG - Intronic
1150992071 17:70271268-70271290 ATGCAACTCTATTCTCAGGAAGG - Intergenic
1151033716 17:70772976-70772998 ATGCCAAGACATTACCAGGCAGG + Intergenic
1153446436 18:5178187-5178209 ATGCATATCAATAAGCAGGAGGG - Intronic
1153508114 18:5824121-5824143 ATGCAAATATGTTACCTGGAAGG - Intergenic
1154425806 18:14271223-14271245 ATGCAAATCCATAACCCAGCAGG - Intergenic
1154428142 18:14287894-14287916 ATGCAAATCCATAACCCAGCAGG - Intergenic
1154433109 18:14323549-14323571 ATGCAAATCCATAACCCAGCAGG - Intergenic
1156440008 18:37175617-37175639 ATGAAAATCAGTTACCAAGAAGG + Intronic
1160123376 18:76149459-76149481 ATGCAAATCCATGTTCAGGGAGG + Intergenic
1160318609 18:77869800-77869822 ATGCAATTACACTCCCAGGAAGG - Intergenic
1163174875 19:15557222-15557244 GTGCAAATCCTCTATCAGGAGGG - Intergenic
1165840503 19:38786681-38786703 ATGCAGATCTGTTACCAGAAAGG + Intergenic
931427851 2:62187404-62187426 CAGCAAAACCATTGCCAGGAAGG - Intergenic
933055575 2:77659493-77659515 ATGCAATGGCATTACCAAGATGG - Intergenic
937115559 2:119402673-119402695 ATGTGAATCAATTACCAGGAGGG - Intergenic
939402050 2:141707370-141707392 ATAAAAATCCATTCCTAGGAAGG + Intronic
939751659 2:146054752-146054774 AGGCAAATACATTACAAGAAAGG + Intergenic
941117442 2:161488239-161488261 ATGTAAATTCATTCCTAGGATGG - Intronic
942460688 2:176166041-176166063 CTGCAAAGCCATTTCCAGTAAGG + Intronic
944086655 2:195855696-195855718 TTGCCAATCCCTGACCAGGAAGG + Intronic
945442145 2:209893251-209893273 TTTAAAGTCCATTACCAGGAAGG - Intronic
947903172 2:233739561-233739583 ATGCAAGTCCAAAACCAGGCAGG - Intronic
947904585 2:233751226-233751248 ATGCAAGTCCAAAACCAGGCAGG - Intronic
948837437 2:240632435-240632457 AGGAAGATCCATTACCAGAAGGG + Intergenic
1170902272 20:20476407-20476429 TTGCAAATCAATTACCATGTAGG - Intronic
1173773101 20:45680862-45680884 ATGCAAATTCATTAAAAGCAAGG + Intergenic
1180726748 22:17952138-17952160 AACCAAATCCTTTCCCAGGATGG - Intronic
951383976 3:22022816-22022838 ATGCAAAATAGTTACCAGGAAGG + Intronic
953165212 3:40458831-40458853 ATGCAAATCCCTCTTCAGGATGG - Intronic
955389603 3:58511370-58511392 ACGCAAAGCCATTATCATGAAGG + Intronic
955826829 3:62956360-62956382 ATGCAAATCAATTACAGGGAGGG + Intergenic
956142452 3:66159492-66159514 ATGCCAGTCCATTAGCATGAGGG + Intronic
957609944 3:82453343-82453365 ATGCAAGTCCAAAACCAGGCAGG - Intergenic
960735471 3:120774859-120774881 ATGCAAACGCAGTACCTGGAAGG + Intronic
962680956 3:137799952-137799974 AAACACATCCATGACCAGGAGGG - Intergenic
965733944 3:171801309-171801331 TTGCAGATCCATTGCCTGGAAGG - Intronic
965803354 3:172516782-172516804 ATGCAAAACCTTTCCAAGGAAGG + Intronic
969956374 4:10895468-10895490 ATGGATATCCATTGCCAGGTAGG + Intergenic
971103167 4:23492235-23492257 ATGCAAATGCATTTCTAAGAGGG - Intergenic
974009783 4:56595863-56595885 ATGTAAATACAGTACCTGGAGGG + Intronic
974497593 4:62652381-62652403 CTTCAAATCCATTTCAAGGAAGG + Intergenic
975230304 4:71924642-71924664 ATGCAAATCCAAAACCCGGCAGG - Intergenic
975496712 4:75043718-75043740 AATCAAATCCTTTAACAGGATGG - Intronic
978591649 4:110330326-110330348 ATGTAAATCCAAAACCAGCAGGG - Intergenic
979186598 4:117803280-117803302 ATGCAAATATATTACCATGCAGG + Intergenic
980730451 4:136816895-136816917 ATGAAAATCCATCACCATGCTGG - Intergenic
981138062 4:141235776-141235798 GTGCGAACTCATTACCAGGATGG + Intergenic
982756994 4:159232834-159232856 ATGCAAATGAGATACCAGGATGG - Intronic
984761147 4:183364080-183364102 CTGGAAAGCCATTCCCAGGAGGG + Intergenic
986133996 5:4957694-4957716 AAGCAAATTCATGATCAGGAAGG + Intergenic
987786600 5:22508443-22508465 ATGCAAATTGTTCACCAGGAAGG - Intronic
987967275 5:24893099-24893121 ATGGAAGTCCAATACCAGTAAGG + Intergenic
991259435 5:64650901-64650923 ATGCAAATCTGAAACCAGGAGGG - Intergenic
991294575 5:65066844-65066866 AAGCAACTTCATTACCAGGAGGG + Intergenic
998550866 5:143076997-143077019 ATGCAATTCCATTCCTAGGTAGG - Intronic
1003638128 6:7853396-7853418 ATGTTGATCCATTTCCAGGATGG + Intronic
1004680255 6:17886982-17887004 GTGTAATTCCCTTACCAGGAGGG - Intronic
1006823709 6:36918272-36918294 ATGTTCATCCATTCCCAGGATGG - Intronic
1010981112 6:82371046-82371068 ATGCAAATCCATTATCACCCTGG + Intergenic
1011381017 6:86742263-86742285 ATGCAAAATCATGATCAGGATGG - Intergenic
1012210290 6:96510374-96510396 ATGCAAGTCCAATACCCAGAAGG - Intergenic
1013061993 6:106643717-106643739 ATTCAAATCCATTATCAGATAGG + Intronic
1014013411 6:116502092-116502114 ATTCTAATCCATTGCAAGGAAGG + Intronic
1015082637 6:129246695-129246717 CTTCAAATCCATTACCAAGTAGG - Intronic
1015099679 6:129461857-129461879 ATGAAAAGACATCACCAGGAAGG + Intronic
1016848950 6:148597099-148597121 CTGCAAAACCATAACAAGGATGG + Intergenic
1017991824 6:159495467-159495489 ATGCAAATAAATTAGAAGGAAGG - Intergenic
1022241809 7:28519525-28519547 GTGCAAACCCATTACCACCAAGG - Intronic
1022808326 7:33845163-33845185 ATGAAAATACATTTCCAGGCCGG - Intergenic
1022858523 7:34340993-34341015 ATGCAAATCTGTTACCTGGAAGG - Intergenic
1024018537 7:45342996-45343018 ATACAAGTCCTTTATCAGGAAGG - Intergenic
1024357402 7:48428236-48428258 ATGCAAATCCATTACCAGGAGGG - Intronic
1028588809 7:92475837-92475859 ATGCAAATGCATTACAGAGAGGG + Intronic
1030516913 7:110550386-110550408 ATGCAAATCCAAAACCCAGAAGG + Intergenic
1041129073 8:54677289-54677311 ATGCATCTGCATCACCAGGAGGG - Intergenic
1043065649 8:75567453-75567475 ATGCAAGTCCAAAACCAGGCAGG + Intergenic
1044951604 8:97440791-97440813 ATGAAAACCCATAACCAGAAAGG + Intergenic
1045029066 8:98117625-98117647 ATGCAAGCCCATTCCCAGGACGG - Intronic
1046307389 8:112386867-112386889 AAGCTATTCCATTACCATGATGG - Intronic
1049263711 8:141653659-141653681 ATGCAAAACCAGGAACAGGAGGG + Intergenic
1050144127 9:2547652-2547674 ATGTAGATTGATTACCAGGAAGG + Intergenic
1050794042 9:9514209-9514231 ATGCAGAGCCCTAACCAGGAGGG - Intronic
1051580993 9:18674338-18674360 ATGGATATCTATTTCCAGGAGGG - Intronic
1052419929 9:28230735-28230757 ATGCACATCCATTTCCTGTATGG - Intronic
1052695690 9:31874448-31874470 ATGTAAATCCATTACCACTTAGG + Intergenic
1056390016 9:86132217-86132239 ATGCCAGTCCATAACAAGGATGG + Intergenic
1057512127 9:95689502-95689524 ATGGAAATCCAGTTCCAAGATGG - Intergenic
1185520444 X:734604-734626 ATGCAAAACCATCATTAGGATGG - Intergenic
1187996635 X:24934063-24934085 GTAAAAATCCATTTCCAGGATGG + Intronic
1189435660 X:40990672-40990694 ATGCAAGTCCAAAACCAGCAGGG + Intergenic
1193264832 X:79455820-79455842 TTACAAATCCATTACCATAAAGG + Intergenic
1194818111 X:98470259-98470281 GTGTAAATCCATAACAAGGATGG - Intergenic
1195868601 X:109461525-109461547 AAGCAAATGCATTAACAAGATGG - Intronic
1197384700 X:125788459-125788481 ATACTACTCCATTAGCAGGAAGG - Intergenic
1197640205 X:128959251-128959273 ATGCAAGTCCAAAACCAGCAGGG + Intergenic
1198796799 X:140405772-140405794 ATCCAAATCCATAAAGAGGAAGG - Intergenic
1199972179 X:152869296-152869318 ATCCAAATCCAGTTCCATGAAGG - Exonic
1201166904 Y:11216908-11216930 ATGAAAATCCATATCCTGGAAGG - Intergenic