ID: 1024360875

View in Genome Browser
Species Human (GRCh38)
Location 7:48466854-48466876
Sequence CCTCACATTGTGCCCTAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024360875_1024360878 6 Left 1024360875 7:48466854-48466876 CCTGACTAGGGCACAATGTGAGG 0: 1
1: 0
2: 2
3: 8
4: 187
Right 1024360878 7:48466883-48466905 GCTGGTTCTCCATTCTCTGTTGG 0: 1
1: 0
2: 0
3: 13
4: 224
1024360875_1024360879 7 Left 1024360875 7:48466854-48466876 CCTGACTAGGGCACAATGTGAGG 0: 1
1: 0
2: 2
3: 8
4: 187
Right 1024360879 7:48466884-48466906 CTGGTTCTCCATTCTCTGTTGGG 0: 1
1: 0
2: 2
3: 18
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024360875 Original CRISPR CCTCACATTGTGCCCTAGTC AGG (reversed) Intronic
901233721 1:7656204-7656226 CCTCACAGTGTGCCACAGACTGG + Intronic
901819925 1:11822286-11822308 CCTCACACTGTTGCCTAGGCTGG + Intronic
901969182 1:12893954-12893976 TCTCACATTGTAACCTAGGCTGG + Intronic
902015990 1:13307827-13307849 TCTCACATTGTAACCTAGGCTGG - Intronic
904227933 1:29040160-29040182 TCTCACTTTGTGGCCTAGGCTGG - Intronic
906359602 1:45142179-45142201 CCTCACTTTGTCACCTAGGCTGG - Intronic
907075205 1:51571920-51571942 CCTCACATTGTATCCCACTCAGG - Intergenic
908189491 1:61687143-61687165 TCTCACTTTGTTCCCTAGGCTGG - Intronic
908385945 1:63642032-63642054 CCTCACCTCTTGCCGTAGTCTGG + Intronic
908498413 1:64718542-64718564 CCTCAGATTGTGACCTTGTTTGG - Intergenic
916148645 1:161764290-161764312 GCTCACTTTGTCCCCTAGGCTGG - Intergenic
917440372 1:175063559-175063581 TCTCACTTTGTGGCCTAGGCTGG - Intergenic
919903249 1:202059373-202059395 TCTCACATTGTCACCTAGGCTGG + Intergenic
921088321 1:211817539-211817561 CCTCACTCTGTCCCCTAGGCTGG - Intronic
921152113 1:212411086-212411108 CCTCAGATTGTGACCTTGTTTGG - Intronic
922527228 1:226313644-226313666 CCTCACATTGTGATCTAGGTAGG - Intergenic
922901481 1:229140270-229140292 CCTCAGATTGTGACCTTGTTTGG - Intergenic
924231579 1:241966434-241966456 CCTCACTTTGTCCCCCAGGCAGG + Intergenic
924669770 1:246111777-246111799 CCTCACATGGTGAAGTAGTCTGG - Intronic
1063955221 10:11259212-11259234 CCTCACATGGTGCTGAAGTCAGG - Intronic
1066623377 10:37381290-37381312 CCTCACTCTGTACCCTAGGCTGG - Intronic
1066649527 10:37641297-37641319 TCTCACATTGTCGCCTGGTCTGG - Intergenic
1066652986 10:37677314-37677336 CCTCAGATTGTGACCTCGTTTGG - Intergenic
1070299497 10:75192929-75192951 TCTCACTTTGTGGCCCAGTCTGG + Intergenic
1070358811 10:75667332-75667354 CCTCACTTTGTTACCTAGGCTGG + Intronic
1070889113 10:79928936-79928958 CGTGCCATTGTGCCCCAGTCAGG + Intergenic
1071339782 10:84634694-84634716 TCTCACTTTGTCGCCTAGTCTGG - Intergenic
1072578916 10:96723129-96723151 CTTCACATTTTGTCCTAGTAAGG - Intergenic
1072663035 10:97374197-97374219 TCTCACTTTGTGGCCTAGGCTGG + Intronic
1073066432 10:100762166-100762188 CCTCACTCTGTTGCCTAGTCTGG - Intronic
1075333252 10:121590304-121590326 CCTGACATTGTCACCTACTCTGG - Intronic
1075847686 10:125558499-125558521 CCTCACTTTGTTACCCAGTCTGG + Intergenic
1078277546 11:9864580-9864602 CCTCACTTTGTTGCCTAGGCTGG + Intronic
1078768412 11:14322408-14322430 CCTCACATTGTCACCCAGGCTGG - Intronic
1079057093 11:17215760-17215782 ACCCACATTTTGCCCAAGTCCGG + Intronic
1079167014 11:18053627-18053649 TCTCACTTTGTTGCCTAGTCTGG - Intergenic
1081657806 11:44868774-44868796 CCTCACTTTCTGCCCTGGTGTGG - Intronic
1083298418 11:61727620-61727642 CCCCACAATGTGCCCTAGAAGGG - Intronic
1083881302 11:65549888-65549910 TCTCACCTTGTGACCTAGGCTGG - Intronic
1084600619 11:70143287-70143309 CCTGAGATTGTGCCCTGGTTTGG + Intronic
1085848173 11:80089943-80089965 CATCATATTGTCCCATAGTCCGG - Intergenic
1088827338 11:113507022-113507044 CCTCTCAATGTCCCCTAGTATGG + Intergenic
1090521459 11:127484030-127484052 CCTCTCATTGTTGCCTAGGCTGG - Intergenic
1096999402 12:55863521-55863543 CATGACACTGTACCCTAGTCTGG + Intergenic
1102560589 12:113759407-113759429 CCTCACATAGTGCTCCAGGCAGG + Intergenic
1106133048 13:26955058-26955080 CCCCACATTGTGCTCTAATCTGG - Intergenic
1107877048 13:44800081-44800103 TCTCACATTGTCCCCTGGGCTGG + Intergenic
1107906184 13:45063270-45063292 TCTCACATTGTTGCCTAGGCTGG + Intergenic
1112632739 13:101180234-101180256 CCTCACATTGTCACCCAGGCTGG + Intronic
1115514660 14:34173522-34173544 CCTCAGATGGGACCCTAGTCAGG + Intronic
1119748471 14:77061242-77061264 CATGCCATTGTGCCCTAGCCTGG - Intergenic
1120328394 14:83056854-83056876 CCTCAATTTGTGCCCTAATAGGG + Intergenic
1121139819 14:91531531-91531553 CCTCACTCTGTGGCCTAGGCTGG + Intergenic
1123005238 14:105318308-105318330 CCTCACTTTGTGGCCCAGACTGG + Intronic
1126052595 15:44700329-44700351 CCTCACTTTGTCACCTAGGCTGG + Intronic
1126820784 15:52501402-52501424 CCTCACAATGTTGCCTAGGCTGG - Intronic
1126869267 15:52970389-52970411 ACTCACACTGTCACCTAGTCTGG + Intergenic
1127074616 15:55313218-55313240 TCTCACTCTGTGGCCTAGTCTGG - Intronic
1128394521 15:67210484-67210506 CCTCACACTGTTGCCTAGCCTGG - Intronic
1129615254 15:77094080-77094102 CCTCACTCTGTGCCCCAGGCTGG - Intergenic
1131852164 15:96554916-96554938 CCTCACTATGTGTCCTAGACTGG + Intergenic
1132367160 15:101265993-101266015 CATCAGAGTGGGCCCTAGTCTGG + Intergenic
1133448648 16:5884880-5884902 TCTCCCATTTTGCCATAGTCTGG + Intergenic
1135428653 16:22362781-22362803 TCTCACTTTGTGGCCCAGTCTGG + Intronic
1136492071 16:30615175-30615197 TCTCACTTTGTCCCCTAGGCTGG - Intronic
1141517961 16:84559112-84559134 TCTCTCATTGTTCCCTAGGCTGG + Intergenic
1143677590 17:8447170-8447192 TCTCACATTGTCGCCCAGTCTGG + Intronic
1144681979 17:17202294-17202316 CCTCACAGTCTGCCCCTGTCAGG - Exonic
1145933095 17:28699963-28699985 CCTCACCTGGTCCCCTAGGCTGG - Intronic
1147873775 17:43606393-43606415 CTTCACTTTGTGCCCATGTCTGG + Intergenic
1151648206 17:75448326-75448348 TCTCACTTTGTGGCCCAGTCTGG + Intronic
1152412430 17:80134626-80134648 TCTCACTTTGTGGCCTAGGCTGG - Intergenic
1152522315 17:80863888-80863910 CCTCACTCTGTTCCCTAGGCTGG - Intronic
1153857020 18:9159846-9159868 CATGACATTGTACCCTAGCCTGG - Intronic
1157548558 18:48564812-48564834 TCTCACCTTGTTCCCTAGGCTGG + Intronic
1158485773 18:57864493-57864515 TCTCACTTTGTCCCCTAGGCTGG - Intergenic
1158553097 18:58453664-58453686 CCTCACATTGTCCCCGAGTCTGG - Intergenic
1161123282 19:2541883-2541905 TCTCACTTTGTCCCCCAGTCTGG - Intronic
1163274822 19:16276964-16276986 CCTCACATGGTCCCCTCTTCTGG - Intergenic
1165538120 19:36467403-36467425 CCTCACATTGTTGCCCAGGCTGG - Intronic
1165919914 19:39290013-39290035 TCTCACATTGTCCCCCAGGCTGG + Intergenic
1167207031 19:48109677-48109699 TCTCGCTTTGTGCCCTAGGCTGG + Intronic
1167265605 19:48481540-48481562 TCTCACTTTGTGCCCTAGACTGG + Intronic
1168033620 19:53701499-53701521 TCTCACACTGTGACCCAGTCCGG + Intergenic
1168640438 19:58027992-58028014 TCTCACGTTGTGACCTAGGCTGG - Intergenic
925098418 2:1225880-1225902 CCTCAGATTGTGCCCTGCCCAGG - Intronic
930408830 2:50997535-50997557 TCTCACTCTGTGCCCTAGGCTGG + Intronic
930556214 2:52898948-52898970 CCTCTCATTGTGGCTGAGTCTGG - Intergenic
930614446 2:53578951-53578973 CCTCAAACTGTGCCCTGGTTGGG - Intronic
934691326 2:96362188-96362210 CCTCACTTTGTCCCCCAGGCTGG - Intronic
934994980 2:98949645-98949667 CCTCAGAATGTGCCCTAATTTGG + Intergenic
936834969 2:116698646-116698668 ACTCACATTGTGCCCAAGAGTGG + Intergenic
937300947 2:120841322-120841344 CCTCACATTGTGCCTTAGTATGG - Intronic
940538412 2:154978127-154978149 CCTCTCCCTGTGCCCTACTCTGG - Intergenic
940583932 2:155618931-155618953 CCTCACACTATTCCCAAGTCTGG + Intergenic
941948939 2:171132833-171132855 TCTCACTTTGTTCCCTAGGCTGG - Intronic
944357736 2:198811978-198812000 TCTCACTCTGTGCCCTAGGCTGG + Intergenic
944702571 2:202259085-202259107 TCTCACTTTGTTGCCTAGTCTGG + Intergenic
948556883 2:238818152-238818174 CCTCACATGGGGCCCTGGTTAGG + Intergenic
1169014418 20:2280043-2280065 CATCACATTGTGCCCTTGGGTGG - Intergenic
1170065983 20:12311149-12311171 CCTCAAATTGGGCCCAACTCTGG + Intergenic
1171130612 20:22649491-22649513 TCTCTCAGTGTGCCCAAGTCAGG - Intergenic
1173898474 20:46569011-46569033 CCTCACATTGTCACCCAGGCTGG + Intronic
1176410242 21:6445830-6445852 CCTCACTCTGTCCCCTAGGCTGG + Intergenic
1176999010 21:15588902-15588924 TCTCACAATGTGGCCTAGGCTGG + Intergenic
1177154818 21:17490987-17491009 TCTCGCATTGTGGCCTAGGCTGG + Intergenic
1177315811 21:19459389-19459411 CCTCACTTTGTGACCCAGGCTGG + Intergenic
1179685735 21:43054152-43054174 CCTCACTCTGTCCCCTAGGCTGG + Intronic
1181641385 22:24201732-24201754 TCTCACTTTGTCACCTAGTCTGG + Intergenic
1183946933 22:41331830-41331852 TCTCACTTTGTCCCCTAGGCTGG - Intronic
949880398 3:8656548-8656570 CCCCACCATGTGCCCTAGGCTGG + Intronic
950173827 3:10857451-10857473 CCTCACATTGTGCTCTGTGCTGG + Intronic
953964246 3:47290655-47290677 CCTCACCTTGTGGTCTAGGCTGG + Intronic
958103401 3:89043534-89043556 CCTCCCATTGTGCACTGCTCTGG - Intergenic
959435529 3:106310655-106310677 TCTCACTTTGTTGCCTAGTCTGG + Intergenic
960078284 3:113513379-113513401 CCTCACTTTGTCACCTAGGCTGG - Intronic
961096337 3:124159709-124159731 TCTCACATTTTGCCCTGGACTGG - Intronic
961761529 3:129172550-129172572 TCTCACTTTGTCCCCTAGGCTGG - Intronic
962316290 3:134361472-134361494 CCTCAGATGCTGCCCTAGCCTGG + Intronic
962381642 3:134903058-134903080 CCTCAACTTGGGCCATAGTCAGG - Intronic
964642020 3:158918576-158918598 CCTTTCATTGTGCCCTACTGTGG - Intergenic
966012701 3:175100807-175100829 TCTCACATTGTTGCCTAGGCTGG - Intronic
971225809 4:24750571-24750593 CCTCAGAATGTGCCCTTGTTTGG + Intergenic
974710052 4:65579468-65579490 GCTCACATTTTGCCATATTCAGG - Intronic
975953344 4:79803398-79803420 TCTCACATTGTCCCCCAGGCTGG + Intergenic
979686916 4:123520736-123520758 TCTCACATTGTCACCTAGGCTGG - Intergenic
981458017 4:144978775-144978797 CCTCACTTTGTCACCTAGGCTGG - Intronic
983548344 4:168987328-168987350 CATTACATTGTGCCATAGTTGGG - Intronic
987297924 5:16570446-16570468 CCTCAAATTTGGCCCTAGTCTGG - Intronic
988458151 5:31406458-31406480 TCTCACTTTGTCACCTAGTCTGG - Intronic
989033559 5:37145275-37145297 TCTCACACTGTGGCCCAGTCTGG - Intronic
990313386 5:54561376-54561398 TCTCACACTGTCACCTAGTCTGG + Intergenic
990470142 5:56107897-56107919 CCTCACTTTGTCACCAAGTCTGG + Intronic
991044665 5:62210482-62210504 CTTCACAGTGTTCCCTAGGCTGG - Intergenic
991385503 5:66084381-66084403 CCTCACTTTGTTGCCTAGGCTGG - Intergenic
992308132 5:75464608-75464630 TCTCACTTTGTGACCTAGGCTGG + Intronic
993227243 5:85182613-85182635 GCTCAGTTTGTGCCCTAGCCTGG - Intergenic
998839237 5:146235707-146235729 TCTCACTCTGTGCCCTAGGCTGG + Intronic
999317310 5:150592666-150592688 CCTCCCATTGAGCCATAGCCTGG + Intergenic
999404201 5:151292660-151292682 GCTCACAGTGTTCCCTAGTGTGG - Intronic
999750171 5:154622372-154622394 CCTCACTTTGTTGCCCAGTCTGG - Intergenic
1002646208 5:180657477-180657499 TCTCACTTTGTGGCCTAGGCTGG + Intergenic
1002694359 5:181074465-181074487 TCTCACTTTGTGGCCTAGGCTGG - Intergenic
1004764279 6:18708146-18708168 ACTCACATTGTGCTGTAGTGTGG - Intergenic
1006028373 6:31161775-31161797 CCTCACCTTCTCCCCTAGTTGGG + Exonic
1013105679 6:107024800-107024822 CCTCACTTTGTCACCTAGGCTGG - Intergenic
1013876642 6:114839178-114839200 TCTCACTTTGTCCCCTAGGCGGG + Intergenic
1014833429 6:126129449-126129471 CCTCACATGGTGCCTGACTCAGG + Intergenic
1015951001 6:138552388-138552410 CCTCACTTTGTCCCCCAGGCTGG - Intronic
1020600555 7:10270058-10270080 TCTCACTTTGTCACCTAGTCTGG - Intergenic
1022523181 7:31020829-31020851 TCTCACACTCTGCCCTTGTCTGG + Intergenic
1023447746 7:40249814-40249836 TCTCACTTTGTCGCCTAGTCTGG + Intronic
1024360875 7:48466854-48466876 CCTCACATTGTGCCCTAGTCAGG - Intronic
1024582298 7:50809879-50809901 CCTCAGTTTGTGGCCTGGTCTGG - Intergenic
1026026681 7:66751058-66751080 TCTCACATTGTCGCCTAGGCGGG + Intronic
1026029662 7:66779472-66779494 CCTCACATTGTTGCCCAGGCTGG - Intronic
1029293795 7:99523132-99523154 TCTCACATTGTCACCTAGGCTGG - Intronic
1030334366 7:108308520-108308542 CCTCCCATTGTAGCCTAGTGGGG - Intronic
1030597928 7:111562063-111562085 CCTCACAAAGGGGCCTAGTCCGG - Exonic
1031099931 7:117466903-117466925 CCTCACTTTGTTGCCCAGTCTGG - Intronic
1031488235 7:122355550-122355572 CCTCACTCTGTGCCCCAGGCTGG - Intronic
1031960815 7:127988254-127988276 CCTGACTTTGTACCTTAGTCTGG + Intronic
1032637316 7:133723822-133723844 CCTCACTATGTTGCCTAGTCTGG + Intronic
1033203295 7:139393398-139393420 CCTCACTCTGTCCCCCAGTCTGG - Intronic
1037469678 8:19195173-19195195 TCTCACATTGTTGCCTAGGCTGG + Intergenic
1038375140 8:27032714-27032736 CCCAACATTGTGTCTTAGTCAGG + Intergenic
1041273809 8:56136855-56136877 CCTCACCTTGTCCCCCAGGCTGG + Intergenic
1042764811 8:72309199-72309221 CCTCTCATGGGGCCCCAGTCTGG - Intergenic
1043125135 8:76383869-76383891 TCTCACTTTGTGTCCTAGGCTGG + Intergenic
1046046874 8:108975069-108975091 CCACAAATGGTGCCCTAGGCTGG + Intergenic
1046405488 8:113767563-113767585 CCTCACGTTGTTACCTAGACTGG + Intergenic
1047177140 8:122552743-122552765 TCTCACATTGTGCAATAATCTGG + Intergenic
1049445504 8:142628773-142628795 CCTCAGATTGTACCCTGGGCAGG - Intergenic
1051988451 9:23120670-23120692 CTTCACTTTGTGCCCCAGTTTGG + Intergenic
1052919924 9:33957057-33957079 TCTCACTTTGTCCCCTAGGCTGG - Intronic
1053564170 9:39230627-39230649 CCCCACTTTGTGCCCTAATCTGG - Intronic
1053829957 9:42068498-42068520 CCCCACTTTGTGCCCTAATCTGG - Intronic
1054132978 9:61388407-61388429 CCCCACTTTGTGCCCTAATCTGG + Intergenic
1054600599 9:67118955-67118977 CCCCACTTTGTGCCCTAATCTGG + Intergenic
1055015220 9:71609229-71609251 CCTCACTTTGTCGCCCAGTCTGG - Intergenic
1057156134 9:92841662-92841684 CCTCACTTTGTTCCCCAGGCTGG - Intergenic
1057646980 9:96885875-96885897 TCTCACTCTGTGGCCTAGTCTGG + Intergenic
1057848347 9:98543558-98543580 CCTCACTATGTTGCCTAGTCTGG + Intronic
1058124064 9:101171365-101171387 CCTCACAGTGTTCCTGAGTCTGG + Intronic
1062017872 9:134300758-134300780 CCTCACATTGTTACCCAGGCTGG - Intergenic
1189813692 X:44803800-44803822 TCTCACTTTGTCCCCTAGTCTGG - Intergenic
1191090177 X:56611800-56611822 ACTCCCATTGTACTCTAGTCTGG + Intergenic
1192384769 X:70656396-70656418 CCTCACTTTGTCACCTAGGCTGG - Intronic
1193027350 X:76858752-76858774 TCTCACATTGTTACCCAGTCTGG + Intergenic
1195491203 X:105472023-105472045 CATCCCATTATTCCCTAGTCTGG - Intronic
1200053753 X:153447743-153447765 CCCCACGTTGTGCTCTAGGCAGG - Exonic
1200925357 Y:8649468-8649490 CCTCACATTGTGCTGTTGGCAGG - Intergenic
1200948351 Y:8867910-8867932 CCTCACATTATGCTGTTGTCAGG - Intergenic
1200987640 Y:9320490-9320512 ACTCACTGTGTGCCCTAGGCTGG - Intergenic
1202273093 Y:23089128-23089150 AATCACATTGTGCCCTTTTCTGG - Intergenic
1202292933 Y:23331554-23331576 AATCACATTGTGCCCTTTTCTGG + Intergenic
1202426090 Y:24722872-24722894 AATCACATTGTGCCCTTTTCTGG - Intergenic
1202444699 Y:24947214-24947236 AATCACATTGTGCCCTTTTCTGG + Intergenic