ID: 1024362263

View in Genome Browser
Species Human (GRCh38)
Location 7:48480471-48480493
Sequence TGCTCTGCCCTGCCACAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024362263_1024362266 6 Left 1024362263 7:48480471-48480493 CCGGTCTGTGGCAGGGCAGAGCA 0: 1
1: 0
2: 2
3: 28
4: 264
Right 1024362266 7:48480500-48480522 TGCGCAGCCTCCAGTGGCCTGGG No data
1024362263_1024362264 0 Left 1024362263 7:48480471-48480493 CCGGTCTGTGGCAGGGCAGAGCA 0: 1
1: 0
2: 2
3: 28
4: 264
Right 1024362264 7:48480494-48480516 CATCATTGCGCAGCCTCCAGTGG 0: 1
1: 0
2: 0
3: 4
4: 81
1024362263_1024362265 5 Left 1024362263 7:48480471-48480493 CCGGTCTGTGGCAGGGCAGAGCA 0: 1
1: 0
2: 2
3: 28
4: 264
Right 1024362265 7:48480499-48480521 TTGCGCAGCCTCCAGTGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024362263 Original CRISPR TGCTCTGCCCTGCCACAGAC CGG (reversed) Intronic
901636334 1:10671972-10671994 AGCTGTGCCATGCCAGAGACCGG + Intronic
902301424 1:15505331-15505353 AGCCCTGCCCAGCCACAGGCTGG + Intronic
902326408 1:15703687-15703709 TGCTCTGAGCTGCCACAGCCCGG - Intronic
902726792 1:18341682-18341704 ACCCCTGCCCTGCCACACACTGG - Intronic
902990943 1:20186485-20186507 GTCTCTGCCCTGCCGGAGACTGG - Intronic
903588762 1:24438371-24438393 GGCTCAGCGCTGCCACAGAAGGG - Intronic
903767529 1:25744278-25744300 TGTTCAGCCCTGCCACCTACAGG + Intronic
904285320 1:29450057-29450079 AGCCCTGGCCTGGCACAGACAGG + Intergenic
904850383 1:33454862-33454884 TGCTCTGCCCAGCAGCAGAGTGG + Intergenic
904971599 1:34423358-34423380 TGCTCTGCACTGCCCCAGGGAGG - Intergenic
906249898 1:44302863-44302885 ATCCCTGCCCTGCCACAAACAGG + Intronic
906526295 1:46495066-46495088 TGCTCTGCCCTGCCCCAGCAGGG - Intergenic
907870400 1:58437816-58437838 TGCTCAGCACTGCCACTGAGAGG - Intronic
909987150 1:82175001-82175023 TGCTCTGACCTGCTCCAGTCTGG - Intergenic
912788255 1:112625200-112625222 TGCTCTGCCATGCCACTGCTGGG + Intronic
913225770 1:116696814-116696836 AGCTCTGCCCTGCCTCACAGAGG - Intronic
914703216 1:150151468-150151490 TGCACGCTCCTGCCACAGACAGG - Intronic
914935604 1:151976989-151977011 TGCTCTGTCCTGCCCCACTCTGG - Intergenic
915366639 1:155320682-155320704 TGCTCGGCCCAGCCAGAGTCTGG + Intergenic
915521306 1:156446010-156446032 TCCTCTTCCCTGCCATAGCCTGG - Intergenic
916576636 1:166072780-166072802 TGCTCTCCCCCGCTACACACAGG + Intronic
918657666 1:187048243-187048265 TGTTTTGCCCTGCAACAGGCTGG + Intergenic
921436424 1:215128693-215128715 TGCTTAGTCATGCCACAGACTGG - Intronic
923086794 1:230708484-230708506 TGCTCAGCCCTGGCACTGACTGG - Intronic
1064111566 10:12543757-12543779 TTCTTTGCCCTGCCACTCACTGG + Intronic
1067851565 10:49758312-49758334 CCCACTGCCCTGCCACAGCCCGG + Intronic
1069412713 10:68169614-68169636 TGCTCTGCCATCCCAAACACTGG + Intronic
1069882529 10:71602693-71602715 AGCTGTGCAGTGCCACAGACTGG - Intronic
1071512012 10:86267979-86268001 TGCTCTGCGCACCCACAGCCCGG + Intronic
1071525561 10:86356005-86356027 TTCTCTGCCCAGCCACCGACAGG - Intronic
1073175780 10:101556476-101556498 TGGACTGCTCTGCTACAGACTGG - Exonic
1074896054 10:117778549-117778571 TTCTCTCCCCTGCCACAAACTGG + Intergenic
1075522558 10:123151649-123151671 CGCTCTGCCCAGCCAGAGGCCGG - Intergenic
1076321145 10:129582379-129582401 TGCTGTGCTCTGCCTCTGACGGG + Intronic
1077147363 11:1052196-1052218 TGCTCTGCTCTGCCCCACCCTGG + Intergenic
1077373241 11:2193435-2193457 TGCTCTGCTCTGCGACACAGTGG + Intergenic
1077633713 11:3827648-3827670 TGCTCAGCCCTGCAACAGGATGG - Exonic
1078068140 11:8091289-8091311 TGGTGTGCCCAGCCACAAACTGG - Intronic
1079027692 11:16961688-16961710 TGCTGTGACCTTCCACACACCGG - Intronic
1079147117 11:17862770-17862792 TGCTCTGTCCTTCCTTAGACAGG - Intronic
1079469347 11:20763685-20763707 TGCTCTGCCGAGCCACAGCGAGG + Intronic
1081940133 11:46934538-46934560 TGCTCTGCCCTGCTAGCAACTGG - Intergenic
1081944000 11:46972415-46972437 TGCACTGCCATCCCACAGACAGG - Intronic
1082003874 11:47409163-47409185 TGGTCTGCTCTGCCTCAGGCTGG - Intronic
1083253469 11:61482676-61482698 AGCTCTGGCTGGCCACAGACTGG - Exonic
1088817460 11:113431522-113431544 TGCTCTGCCCTAGCTCAGAAGGG + Intronic
1089492665 11:118893651-118893673 ATCTCTGCCCTGCCACAGAGGGG + Exonic
1089533891 11:119149307-119149329 TGCTCAGCGCTGCCACGGACCGG - Exonic
1089913435 11:122127341-122127363 AGTTCTGCCATGCCACACACAGG + Intergenic
1090260340 11:125314734-125314756 TGCCCTGCCCTGCCCCCGAGAGG + Intronic
1091786598 12:3246691-3246713 TGCTCTGCCCTACCCCAAAAGGG - Intronic
1092209281 12:6635920-6635942 TGCTCTGCGCTGCCCCAAGCTGG + Exonic
1096468665 12:51863282-51863304 TACTCTGCCCTGCCTCTAACAGG + Intergenic
1101224666 12:102676089-102676111 TGCTCTGCCATGGTAAAGACAGG + Intergenic
1102492454 12:113297467-113297489 TCCTCTTCCCAGCCACAGAACGG + Exonic
1103271063 12:119674162-119674184 TACTCAGCTCTGCCACACACGGG - Intronic
1104409147 12:128543679-128543701 AGCTCTGCCCTGCCACCTCCTGG + Intronic
1105027527 12:132858992-132859014 TGCCCAGCCCTGCCCCACACGGG + Intronic
1105503444 13:20991101-20991123 TGCCCTGCCCTGACAGAGTCAGG - Intronic
1105741162 13:23324484-23324506 TGCTCACACCGGCCACAGACAGG - Exonic
1106777012 13:33017791-33017813 TTCCCTGCCCTGCCGCAGAAGGG - Intronic
1113066032 13:106375037-106375059 TGGCCTGCCCTGCCACAAAGAGG - Intergenic
1114866607 14:26602103-26602125 TGCGCTGCCCTTACACAGGCTGG + Intergenic
1116898628 14:50340964-50340986 GGCTCTGCCCTGCCCCAACCTGG + Intronic
1118894862 14:69937377-69937399 TGCTCTGCCCTGGAACTGAAAGG + Intronic
1118984248 14:70739964-70739986 TGCTCTGTCCAGCCACCGACTGG - Intronic
1121174361 14:91879630-91879652 AGCTCTGCTCTGCCACAAACAGG + Intronic
1121486646 14:94321492-94321514 TGCCCTGCCCTGCCCCACAGTGG - Intronic
1121600070 14:95196768-95196790 TGCTCTGCCCAGGCCCAGCCAGG + Intronic
1122195309 14:100080394-100080416 TGCTGTGCCCTGCCCCATGCTGG + Intronic
1122325378 14:100878443-100878465 TGCACTGCCCAGCCCCACACAGG - Intergenic
1122780182 14:104140168-104140190 CACCCTGCCCTGCCCCAGACAGG - Intronic
1122857361 14:104566244-104566266 GGCTCTGCCCTGGCACACTCAGG + Intronic
1123042568 14:105496402-105496424 TGCTCTGCTCCGCCCCAGAGGGG + Intronic
1125551356 15:40547320-40547342 TGCCCTGCCCTGCCTGAGCCTGG - Intronic
1125971260 15:43913581-43913603 TGTTCTCCCCTGCCACACAAGGG + Intronic
1127704691 15:61535324-61535346 TGCCCCTCCCTGCCACAGAAAGG - Intergenic
1129149254 15:73677406-73677428 TCCTCGGCCCTGCAGCAGACAGG - Intergenic
1129757222 15:78105698-78105720 TGCTCTGCCCTGCCCAAGCCCGG + Intronic
1129900716 15:79146610-79146632 TTCACTGCCATGCCACACACTGG + Intergenic
1131512739 15:93058275-93058297 TGCTCTGCCCCACCACAGTAAGG - Intronic
1131923695 15:97358385-97358407 TCCTCTGCCTTGCCAAAGAGAGG + Intergenic
1132247572 15:100309495-100309517 AGCTCTGGCCTGCCTCAGTCTGG + Intronic
1132372731 15:101309480-101309502 CGCTTTGCCCTGCCACATTCTGG + Intronic
1132654248 16:1035258-1035280 TCCTCTGCCCAGCCCCACACTGG - Intergenic
1132709419 16:1259802-1259824 TGCTCTGCTCTGCCCCACTCTGG + Intergenic
1132796586 16:1726819-1726841 GGCTCTGACCTCACACAGACAGG + Intronic
1133050419 16:3114354-3114376 TGCTCTGCCCCTGCACAGAATGG - Intronic
1134065962 16:11228421-11228443 AGCTCTGACCTGGCACAGTCAGG - Intergenic
1134202889 16:12213606-12213628 TGCTGTGACCTTCCACAGCCTGG - Intronic
1134689061 16:16179025-16179047 TGCCCTGACCTGCCACAGCCTGG - Intronic
1135867468 16:26117480-26117502 TGCTTTGCCTTCCCAGAGACTGG + Intronic
1137256476 16:46779051-46779073 TGCTCTTCCTGGACACAGACAGG + Intronic
1137512326 16:49112454-49112476 TGCCCTGACCTGCCTCAGAGTGG - Intergenic
1137559636 16:49494441-49494463 TGCTCTGCACTGGCACAGTGAGG + Intronic
1138222980 16:55268849-55268871 TGCCCTTCCCAGCCACAAACAGG + Intergenic
1139327952 16:66166601-66166623 TTCTCTGCCCAGCCACTCACTGG + Intergenic
1139596640 16:67962042-67962064 TGCTCTGCCCAGCCACCTCCTGG + Intronic
1139707700 16:68752987-68753009 TCCTCTGCACTGCCAAAAACTGG - Intronic
1140606351 16:76543729-76543751 TGCTGTGACCTGCCACTGGCTGG + Intronic
1141410306 16:83828560-83828582 CCCTCTGCCCTGCCAGAGGCGGG - Intergenic
1142149184 16:88505264-88505286 TGGGCTGCCCTTCCACAAACGGG - Intronic
1142261284 16:89043563-89043585 TGCACGGCCCTGCCCCAGCCCGG - Intergenic
1142291267 16:89194596-89194618 GGCTCTGCCCTGCCCCAGCAAGG - Intronic
1142302595 16:89267197-89267219 TCCTCTGCCTTTGCACAGACCGG - Intergenic
1143233565 17:5378683-5378705 TGCTCTCCCCTTCCACACACTGG + Intronic
1144519571 17:15945018-15945040 TGCTCCGCCCAGCCCGAGACGGG + Exonic
1145292863 17:21563655-21563677 TGCTCTGCTCTTCCTCACACAGG - Intronic
1145387098 17:22422276-22422298 TGCTCTGCTCTTCCTCACACAGG + Intergenic
1146289214 17:31596167-31596189 TGCCCTGCCCTGCCATAGGGTGG + Intergenic
1147648966 17:42051071-42051093 TGCTCTGCCATCCCACGGCCTGG - Intronic
1147656981 17:42096659-42096681 TGCTCTGCCCTCCCACCTCCAGG - Intergenic
1149441489 17:56678232-56678254 TGCTTTGCTGTGACACAGACAGG - Intergenic
1149796106 17:59521582-59521604 TGCTCTGCCTTGCCACGTTCGGG + Intergenic
1150130184 17:62664933-62664955 TGCTCTGCCCTACCACGGTGAGG + Exonic
1151652997 17:75481490-75481512 TGCTGCCCCCTGCCACAGCCTGG - Intronic
1152008611 17:77697264-77697286 TGCTCTGAGCTGCTGCAGACGGG + Intergenic
1152057799 17:78044979-78045001 TGTCCTGCCCTCCCAAAGACAGG - Intronic
1152091397 17:78249650-78249672 TGGGCTGGCCTCCCACAGACAGG - Intergenic
1152235230 17:79135177-79135199 TCCACTGCCCGGCCACAGCCAGG + Intronic
1153457654 18:5296814-5296836 GGGTCTGGACTGCCACAGACGGG - Intronic
1155193625 18:23453094-23453116 TGCCCTGCCCTGCCCGACACAGG + Exonic
1157471673 18:47993617-47993639 TGATCTGACATGCCACAGGCTGG - Intergenic
1157718592 18:49906391-49906413 TGCCCTGAGCTGCCACAGTCTGG + Intronic
1160505194 18:79422972-79422994 TGCCCTGCCCTGCCCCGGATGGG - Intronic
1160777460 19:862579-862601 TTCTCTTCCCTGCCACAGCAGGG - Intronic
1160895242 19:1399383-1399405 TGCTCCGCCATCCCACAGCCAGG + Intronic
1161477874 19:4496414-4496436 TGCTCTGCCCCTCCACACCCTGG + Intronic
1162797370 19:13093939-13093961 GGCGCTGCCTTCCCACAGACAGG - Intronic
1163129723 19:15264963-15264985 TGCTTTCTCCTGCCACAGGCAGG - Intronic
1163253712 19:16142216-16142238 TGCTCTTCCCTCCCCCAGCCTGG + Intronic
1164472946 19:28550976-28550998 TGCGATGCTCTGCCACAGTCAGG - Intergenic
1166863128 19:45821106-45821128 TGCTGTGCCCTGGCACAGAGTGG - Intronic
1167095310 19:47372271-47372293 AGCTCTGCCCTGGCACAGGCAGG - Intronic
1167444209 19:49527952-49527974 GGCTCTGCGCTGCCAGAGGCGGG + Exonic
1167634891 19:50648798-50648820 TGCTCATCCCTGCCCCAGCCAGG - Intronic
925742337 2:7017197-7017219 GGCTCAGCCCTCCCAGAGACAGG + Intronic
927211488 2:20641672-20641694 TTCTCTGCCCTGCGTCAGGCAGG + Intronic
928721356 2:34125252-34125274 TGCTCTGCCCCTCCAAAGTCCGG + Intergenic
929580599 2:43079649-43079671 TGCACTCCACTGCGACAGACTGG - Intergenic
929816236 2:45234520-45234542 TGCTTTGCTCTCCCACAGAAAGG - Intergenic
930025232 2:47025489-47025511 GGCTCTGCCCTGCGTCAGCCTGG + Intronic
930729311 2:54712476-54712498 TGCTCTGCCCTACTCAAGACTGG + Intergenic
932566474 2:72914420-72914442 TGCTGAGCTCTGCCAGAGACTGG - Intergenic
932626344 2:73299357-73299379 TGCTCTGCTGTGGCATAGACTGG + Intergenic
933781967 2:85808870-85808892 GGCCCTGCCCTACCACAGAGGGG + Intergenic
933811467 2:86035393-86035415 AGTCCTGACCTGCCACAGACTGG + Intronic
935467078 2:103411281-103411303 TGCTCTGCCCAGCCATCCACTGG + Intergenic
935734113 2:106092612-106092634 TCCTCTGCCCTGCCCAAGACTGG + Intergenic
936027839 2:109047008-109047030 TGCCCTGCAGTGCCAGAGACTGG + Intergenic
936343255 2:111656315-111656337 TTCTCAGCCCTGCCACAGCTAGG + Intergenic
938068274 2:128293303-128293325 TGCTCTGCCCAGGCCCAGGCTGG - Intronic
938766176 2:134461841-134461863 TGCTTGGCTCTGCCACAGCCTGG + Intronic
941991686 2:171563264-171563286 AGCTCAGCCCTGGCACACACAGG + Intergenic
942326724 2:174782289-174782311 TGCTCTGCGCCCCCACAGAGCGG + Intergenic
943125054 2:183785927-183785949 TTCTCGGCCCTTTCACAGACAGG + Intergenic
945935629 2:215900293-215900315 TTCTCTGCCTTGCCTCAGAGCGG - Intergenic
946359798 2:219212464-219212486 TGCTCTTCCCTGCCCCAGATGGG + Exonic
947820366 2:233064715-233064737 GGCTCTGCCCCGCCCCACACAGG - Intronic
947935339 2:233999138-233999160 TGCCCTGCCCTGCCCCAGGAGGG - Intronic
948404652 2:237708165-237708187 TGCCCAGCCCTGCCACCTACAGG + Intronic
948976445 2:241466492-241466514 GGCCCGGCCCTGCCACAGAGAGG + Intronic
1168766102 20:382179-382201 TGCTGTTCCCTGCCACACTCGGG - Intronic
1171336445 20:24389712-24389734 TGAACTGCCTTGCCACAGTCAGG - Intergenic
1172940180 20:38648772-38648794 TACTCTGGCCTCCCACAGAAGGG - Intronic
1173299067 20:41784403-41784425 AGCTCTGCCCTCCCACACATGGG - Intergenic
1174500605 20:50981316-50981338 TGCACAGCCCTGCCACAAGCTGG - Intergenic
1174549309 20:51350203-51350225 TGCCCTGCTCTGCCACTGGCTGG + Intergenic
1175392660 20:58636855-58636877 TTCCCTGCCCTGTGACAGACAGG - Intergenic
1175852031 20:62098847-62098869 GGGTTTGTCCTGCCACAGACAGG + Intergenic
1175932532 20:62499381-62499403 TGCCCTGCCCTTCCCCAGGCAGG - Intergenic
1176109122 20:63403149-63403171 TGCCCTTCCCTCCCACAGCCTGG - Intergenic
1176378616 21:6100470-6100492 TGCTCTCCCCTGCCCCACCCCGG - Intergenic
1179403794 21:41108816-41108838 TGCTCTGCCAAGCCAGAGACGGG + Intergenic
1179744859 21:43437767-43437789 TGCTCTCCCCTGCCCCACCCCGG + Intergenic
1180245409 21:46544127-46544149 TCCTCAGCTCTGCCACAGAAAGG - Intronic
1182300056 22:29332130-29332152 TGCTCTGCTCTGCCCCAGCCTGG + Intronic
1183292504 22:37011320-37011342 TCCTCTGCCCTGCCCAGGACTGG - Exonic
1184021850 22:41826390-41826412 TTCTCTGCCCTGCCAGGGCCTGG - Intergenic
1184837127 22:47030579-47030601 TGCCTTGCCCTGCCACATAAGGG + Intronic
1185331058 22:50252218-50252240 TGCCCTGCCCTGCCCCTCACTGG + Intronic
951038969 3:17967237-17967259 TGCTCTGTCCTGCCAGCAACAGG - Intronic
951590217 3:24256366-24256388 TCCTCTTCCCAGCCAAAGACTGG + Intronic
953497744 3:43403016-43403038 TGCTCTGCCCTCCCACAGCAGGG + Intronic
954794107 3:53152813-53152835 TGCTCAGCCATGCCTCTGACTGG - Intergenic
955684621 3:61537599-61537621 TGGTCTGACCTTCCAAAGACAGG + Intergenic
959263805 3:104113419-104113441 AGCTCTGTCCTGCCTCAGGCAGG - Intergenic
960237319 3:115298883-115298905 TTCTCTGGCGTGGCACAGACAGG - Intergenic
961116439 3:124334078-124334100 TGCTCTGCCCTCCACCAGGCCGG + Intronic
961623863 3:128245577-128245599 TCCTCTGGCCTCCCACAGAACGG - Intronic
962809600 3:138949275-138949297 TGCTCAGCCCTGCAGCAGCCAGG + Intronic
964631846 3:158818988-158819010 TTCACTGCCCTACCACAGCCCGG - Intronic
965733043 3:171792572-171792594 TTCCCTGCCCAGCCCCAGACTGG + Intronic
966772111 3:183513494-183513516 TGATCTGCCCTGACACAGGAAGG + Intronic
966879815 3:184343835-184343857 TGCCCTGGCCTGCCAGAGAAAGG - Intronic
968542855 4:1177175-1177197 TGCTCTGCCCAGCTGCAGACAGG - Intronic
969397767 4:6933817-6933839 TGCTCTGCCCTTCCCCTGCCCGG - Intronic
969441984 4:7222706-7222728 CGCTCTCTCCTGCCACAGCCTGG - Intronic
969447255 4:7252348-7252370 AGCTCTGCCCTGCCCCACCCGGG - Intronic
977711542 4:100132289-100132311 GGCTTTGTCCTGCCACAGAAAGG + Intergenic
978479633 4:109174563-109174585 TGCCCTGCAGTGCCACAGAGGGG - Intronic
980427417 4:132644453-132644475 TCCTCTGCCCTCCCACAAAGAGG - Intergenic
982564387 4:156970849-156970871 TGCCCTGGCCGGCCAGAGACAGG - Exonic
984195611 4:176655473-176655495 TACTCAGCCCTGCAACAGCCAGG + Intergenic
985514999 5:337832-337854 TGCTCACCACTGCCATAGACAGG - Intronic
985572052 5:652142-652164 TACCTTGACCTGCCACAGACAGG - Intronic
987315576 5:16720114-16720136 TGCTCTGCCCTGACAAATGCAGG + Intronic
988193502 5:27969309-27969331 AGCTATTCCCTGCCACAGAGAGG - Intergenic
991059258 5:62355491-62355513 TGCTTTGCCCTCCCAAAGACAGG - Intronic
991454102 5:66784007-66784029 TGTTCTGCCCTCCCACTGGCAGG + Intronic
992751288 5:79865011-79865033 TGCTCTTTCCTGACATAGACAGG + Intergenic
993605279 5:89982909-89982931 TGCTCTGCCCAGCCACGTAGTGG + Intergenic
993719887 5:91311831-91311853 TGCCCTGCCCTGACCCTGACTGG - Intergenic
997399447 5:133591212-133591234 TGAGCTGCCCAGCCACAGACAGG + Intronic
997581578 5:135020441-135020463 TGCTGGGCCCCGCCACAGCCTGG + Intergenic
997933258 5:138089319-138089341 TGCTCTGCCCCTCCACACGCGGG + Intronic
998193197 5:140043701-140043723 TGCTCGGTCCTGCCACCGCCTGG + Intergenic
998571123 5:143259049-143259071 TGCTCTCCCTTGTCACAGATTGG + Intergenic
998818906 5:146040865-146040887 TGCTCTGCCCTGCCAGGGAAAGG + Intronic
999285958 5:150394419-150394441 TGCCATGCCTTGACACAGACTGG - Intronic
999893520 5:156004492-156004514 TGATTTTCCCTGCCGCAGACTGG + Intronic
1001674237 5:173499162-173499184 TGCTCTCTCCTGCCCCAGACAGG - Intergenic
1003460138 6:6321069-6321091 GGGTCTGCCCTCCCACAGACAGG + Intergenic
1003640601 6:7872088-7872110 TTCTCTGCCCTGCCCTTGACTGG + Intronic
1004061210 6:12199896-12199918 TTCTGTGCCCCACCACAGACAGG - Intergenic
1004274759 6:14225827-14225849 TGATGTGCCCTCCAACAGACTGG - Intergenic
1006020420 6:31114631-31114653 AGCTCTGTTCTGCCACAGGCTGG + Intergenic
1008498529 6:52156673-52156695 TGCTGTCCACTGCCACAGGCAGG - Intergenic
1011418834 6:87151731-87151753 TGGGCAGCCCAGCCACAGACAGG - Intergenic
1013034730 6:106370306-106370328 TCTTCTGCCCTGACACAGGCAGG + Intergenic
1013991527 6:116259160-116259182 TGCGCCACCCTGGCACAGACAGG + Intronic
1015332608 6:131997995-131998017 TGCTCCCACCTACCACAGACTGG + Intergenic
1015857591 6:137641624-137641646 TGCTCGGCCCTGGCACTGCCTGG - Intergenic
1017058940 6:150462987-150463009 TGCTGTGTCCTGCCAGAGGCAGG - Intergenic
1018054542 6:160040662-160040684 TCCTCTGCGGTGCCACCGACGGG + Exonic
1018091101 6:160347823-160347845 TGCCCTGCCCTGCCCCACATGGG + Intergenic
1019052518 6:169194059-169194081 TGCTCTGCCCTGACTCAGCTTGG + Intergenic
1019707598 7:2503912-2503934 TTATCTGCCTTGCCACAGCCAGG - Intergenic
1019910269 7:4096251-4096273 GGCTCTGCCCTGCCACAGCCAGG - Intronic
1020156244 7:5727019-5727041 TCCTATCCCCTGCCACAGTCAGG - Intronic
1022038436 7:26556398-26556420 TTCTCTGCCGAGCCCCAGACAGG - Intergenic
1023020849 7:36010654-36010676 TTCTCAGCTCTGCCATAGACTGG + Intergenic
1024208197 7:47181757-47181779 TGCTCAGCCCTGTCCCAGCCCGG + Intergenic
1024290429 7:47799873-47799895 TGCTCTGCCCAGCCAGACCCAGG - Intronic
1024362263 7:48480471-48480493 TGCTCTGCCCTGCCACAGACCGG - Intronic
1024365139 7:48511411-48511433 AGCACTGCCCTGTCTCAGACAGG + Intronic
1026586125 7:71657605-71657627 GGCTGTGCTCTGCCACAGCCTGG - Intronic
1027352633 7:77327386-77327408 GGATCTGCCCTGCCAGACACGGG - Intronic
1029814124 7:103075818-103075840 CGCTCGGCCCGGCCTCAGACGGG + Exonic
1032084527 7:128877063-128877085 TGCTCGGCCCAGCCCCAGCCGGG - Exonic
1032844009 7:135737174-135737196 TGCTCTTCCCTGCCGCCCACCGG - Exonic
1033284506 7:140028620-140028642 TCCTCTGCCCTGCCAGACCCAGG - Exonic
1034268268 7:149791490-149791512 TGCCCTGGCCTTCCACAGTCAGG - Intergenic
1034411066 7:150942440-150942462 TGCACTGCCCAGCCACAGGCAGG - Intergenic
1034469468 7:151247765-151247787 AGCACTGTCCTGCCACAGGCAGG - Intronic
1034475650 7:151280073-151280095 TGCTCTGCCCTGCACCACCCGGG - Intergenic
1036678422 8:10853171-10853193 TTCCCTGCCCTCCCACACACAGG - Intergenic
1038154155 8:24971648-24971670 TGCCCTGCCCTGCCTTGGACTGG - Intergenic
1038195565 8:25363771-25363793 TGGTCTGCTCTGCCTCACACCGG + Intronic
1038331178 8:26610660-26610682 TGCTCTCCCCTGGCATAGAAGGG + Intronic
1038571149 8:28663863-28663885 TCCTCAGCCCTGCCCCAGAGAGG - Intronic
1041008919 8:53522624-53522646 TGCCCTGCCCTGCCATTGCCCGG - Intergenic
1042438246 8:68793653-68793675 TGCTCTGCCCTACTTCAGACAGG - Intronic
1043941071 8:86196677-86196699 TGCTCTGCCCTGCCATAGTCTGG + Intergenic
1044790157 8:95838788-95838810 CCCTATGCCCTGTCACAGACTGG + Intergenic
1044839925 8:96328812-96328834 TCCTCTGCACAGCCACAGTCTGG - Intronic
1045545538 8:103125020-103125042 TGCTCTGCTCTGCAGGAGACAGG + Intergenic
1048857805 8:138698863-138698885 TGCTCCGCTCTGGCAGAGACAGG - Intronic
1049065532 8:140310793-140310815 TGCTCTGCACTGCCTCTGCCTGG - Intronic
1049099157 8:140567031-140567053 TGCTGTGCCCTGGCACGGATCGG + Intronic
1049316981 8:141974580-141974602 TGCTGGGCCCTGCAACAGGCGGG - Intergenic
1049592378 8:143468529-143468551 TGCACTGCCCGGCTGCAGACGGG + Exonic
1049746489 8:144265362-144265384 GGCTCTGGGCAGCCACAGACAGG + Intronic
1049805241 8:144535865-144535887 TGCTGAGCACTGCAACAGACAGG - Intronic
1051100406 9:13514345-13514367 TGGTTTGCTCTGCCTCAGACAGG - Intergenic
1051692647 9:19732729-19732751 TGGTCTGCCCTGAGACAGGCAGG - Intronic
1055554316 9:77459900-77459922 TCCTCTGCCCGGCCACAGTGGGG - Intronic
1057142508 9:92735868-92735890 TGCACTGCCCTGACAGGGACCGG - Intronic
1057420211 9:94906168-94906190 TACTGTGCCCAGCCAGAGACAGG - Intronic
1058432002 9:104928073-104928095 CGCCCTGCCCTGCCGCAGCCCGG + Exonic
1059391927 9:114004665-114004687 AGCCCTGCCCTGACCCAGACTGG + Intronic
1060973696 9:127753221-127753243 TTATCTGCCCTGCCACTGCCTGG - Intronic
1061746071 9:132741117-132741139 TGCCGTGACCTGGCACAGACTGG - Intronic
1061792259 9:133064905-133064927 GGCGCTGCCCTGCCCCAGGCTGG - Intronic
1062658025 9:137614201-137614223 GGCTCTGACCTGCAGCAGACTGG - Exonic
1185493575 X:537539-537561 TGCACTGTCCTCCCAGAGACGGG + Intergenic
1187678381 X:21741030-21741052 TGCTTGGCCCAGCCACAGATGGG - Intronic
1188565704 X:31523697-31523719 TGCTCCGTCCTTCCACAGGCAGG - Intronic
1189919392 X:45888685-45888707 TGCTTTGCCCAGCAACAGAGGGG - Intergenic
1190054159 X:47172200-47172222 AGCTCTGCTCTGCCACTCACTGG - Intronic
1194337468 X:92665723-92665745 TGCTCTGGCTTTCCACATACAGG - Intergenic
1195065281 X:101233932-101233954 TGCTCTGCCCTGCCTTTGAGAGG - Intronic
1195935423 X:110120933-110120955 AGTTCTGCCCTGCCACTGGCTGG + Intronic
1196384967 X:115139729-115139751 AGTGCTGCCCTGCCACAGAGGGG + Intronic
1199935440 X:152569040-152569062 TGCTCTCCCCTCCCACCAACAGG - Intergenic