ID: 1024370375

View in Genome Browser
Species Human (GRCh38)
Location 7:48576398-48576420
Sequence CTTCACATGGAGAATCTGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 220}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024370375_1024370381 10 Left 1024370375 7:48576398-48576420 CCTACCAGATTCTCCATGTGAAG 0: 1
1: 0
2: 4
3: 21
4: 220
Right 1024370381 7:48576431-48576453 AATCCTTTCGTGCTTTCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024370375 Original CRISPR CTTCACATGGAGAATCTGGT AGG (reversed) Intronic
900406931 1:2496870-2496892 CTTCTGCTGCAGAATCTGGTGGG - Exonic
901441090 1:9278919-9278941 CTCCCCATGGGGATTCTGGTAGG + Intergenic
902336043 1:15755619-15755641 CTTCATAGCAAGAATCTGGTGGG - Intergenic
902340742 1:15782113-15782135 TTTCACATGGGGAAACTGGTGGG + Intronic
903736984 1:25536208-25536230 CTTCACATGGAGCATGTGTGGGG - Intergenic
911041245 1:93592588-93592610 CTGCACATGGGGACTATGGTAGG + Intronic
911836178 1:102622050-102622072 CTTCTCATGGAGTATCTTGTGGG + Intergenic
912953182 1:114134672-114134694 CCTGACATGGAGAACCTTGTTGG + Intronic
916165368 1:161962044-161962066 CTTCACATGGAGTTTTGGGTGGG + Exonic
917694126 1:177502672-177502694 CTTGACTATGAGAATCTGGTGGG - Intergenic
919031637 1:192250623-192250645 CTTCTCATGGAGTATCTTATTGG + Intergenic
920182966 1:204143809-204143831 CATCACAAGGAGATACTGGTGGG - Intronic
923136058 1:231120383-231120405 CTTCACCATGAGAACCTGGTGGG - Intergenic
924134580 1:240950240-240950262 CTTCACCATGAGAATCTGGTGGG - Intronic
924567916 1:245213290-245213312 GCTCACATGGAGACCCTGGTGGG + Intronic
924883848 1:248190608-248190630 CTTCTCATGGAGTATCTTATTGG - Intergenic
1063807781 10:9666937-9666959 CTTCACCCTGAGAATCTGGTGGG + Intergenic
1064703846 10:18050004-18050026 CTTCACTGTGAGAACCTGGTAGG - Intergenic
1066702847 10:38148373-38148395 TTTCACATGGAGAATTTCATGGG + Intergenic
1066987578 10:42481629-42481651 CTGCACATGGGGCACCTGGTGGG + Intergenic
1067008620 10:42690245-42690267 CTTCTCCTGCAGAATCTGGAGGG - Intergenic
1067197553 10:44135380-44135402 CTTTACCATGAGAATCTGGTTGG - Intergenic
1069371104 10:67748257-67748279 CTTCTCATGGAGTATCTTGCTGG - Intergenic
1070897998 10:80001847-80001869 CTTTACTTTGAGAACCTGGTAGG - Intergenic
1071769252 10:88706476-88706498 CTTCAGATGGAGAGTCTTCTAGG + Intergenic
1072360670 10:94655903-94655925 CTTCTCATGGAGTATCTTATTGG + Intergenic
1072925328 10:99612025-99612047 CCTCACATGGAGAATGTTTTTGG + Intronic
1073124599 10:101141508-101141530 CTTATCCTGGAGAATCTGATAGG + Intergenic
1073466580 10:103697799-103697821 CTGCACAGGGAGAGGCTGGTGGG + Intronic
1074177392 10:111022860-111022882 CTTCACTATGAGAACCTGGTAGG - Intergenic
1077924580 11:6668045-6668067 CTTTACAGCGAGAACCTGGTGGG + Intergenic
1079073141 11:17365678-17365700 CTTTACTGTGAGAATCTGGTGGG + Intronic
1079426233 11:20344327-20344349 CTTCTCATGGAGTATCTGAGTGG - Intergenic
1080214870 11:29828712-29828734 CTTCTCATGGAGTATCTTATTGG - Intergenic
1082609403 11:55280272-55280294 CTTCACAGGGGGGTTCTGGTGGG + Intergenic
1083062651 11:59890767-59890789 CTTCTCATGGAGTATCTTATTGG + Intergenic
1083374784 11:62210750-62210772 CTTCACATTGAGAATCTTTAGGG + Intronic
1085466663 11:76728659-76728681 CTTCTAATGGAGGGTCTGGTGGG - Intergenic
1085682731 11:78593442-78593464 CTTCACCCTGAGAACCTGGTAGG + Intergenic
1086472048 11:87124391-87124413 CTTTAGAGGGAGAATCTGTTTGG + Intronic
1087157973 11:94923126-94923148 CTTCACACTGAGGATCTGATTGG - Intergenic
1087333438 11:96812814-96812836 CTTCATCATGAGAATCTGGTGGG + Intergenic
1089020777 11:115212207-115212229 CTACACATGAAGAATCTAGCTGG - Intronic
1089059863 11:115617741-115617763 GTTCAGATAGAGAATCTGGCTGG + Intergenic
1093186278 12:16022867-16022889 CTTCACTGTGAGAACCTGGTGGG - Intronic
1094273616 12:28644621-28644643 CTTCTCATGGAGTATCTTATTGG + Intergenic
1095987526 12:48009570-48009592 CTTCACATGGAACTTCTGCTGGG - Intergenic
1097583108 12:61482388-61482410 CTTCTCATGGAGTATCTGACTGG - Intergenic
1098209508 12:68148811-68148833 CTTCACCAGGAGAACTTGGTGGG + Intergenic
1098736849 12:74115857-74115879 CTTCACTCTGAGAATATGGTGGG + Intergenic
1101556448 12:105814251-105814273 CTTCCCCTGGAGAAGCTGCTGGG - Intergenic
1105331888 13:19425466-19425488 AGTCACATGGAGAAACTGGGAGG - Intronic
1105577180 13:21664745-21664767 CTTCACAGGGAGAACCTGGTAGG + Intergenic
1105919931 13:24953810-24953832 AGTCACATGGAGAAACTGGGAGG - Intergenic
1109209149 13:59514526-59514548 CTCCAGATGGAGACTCTGGATGG + Intergenic
1109433408 13:62266954-62266976 CTTCACATGGTAGAACTGGTAGG + Intergenic
1109956036 13:69567579-69567601 CTACACATGGAGGAGGTGGTTGG - Intergenic
1116341460 14:43728517-43728539 CATTACAGGGAGAATCTTGTTGG + Intergenic
1117751218 14:58925392-58925414 CTTCTCATGGAGTATCTTATTGG - Intergenic
1119142423 14:72279457-72279479 CTTCTTATGGAGGATCTGGAAGG - Intronic
1125098764 15:35885595-35885617 CTACATATGGAGGATATGGTGGG + Intergenic
1127754148 15:62074473-62074495 CTTCACCATGAGAACCTGGTGGG + Intergenic
1128228633 15:66019659-66019681 CTTCGGATGGAGAATTGGGTTGG + Intronic
1133636948 16:7676125-7676147 CTTCAGACGGAGAATTTGTTTGG - Intronic
1136633757 16:31506130-31506152 CCACACGTGGACAATCTGGTTGG - Intronic
1137927895 16:52558620-52558642 CTTGAGATAGAGAATCTGATTGG + Intergenic
1143666594 17:8365677-8365699 CTTCACATGCAGAATCTCGCTGG + Intergenic
1143813230 17:9489484-9489506 CTTTACATGCATAATTTGGTGGG - Intronic
1146623800 17:34420797-34420819 CTTCACATGGAGATTCAGGTAGG - Intergenic
1153016800 18:589933-589955 CTTCACCCTGAGAGTCTGGTGGG + Intergenic
1153362490 18:4213275-4213297 CTTCACATGGAGATTCTCTTGGG + Intronic
1156019265 18:32580913-32580935 AGTCACATGGAGACTCTGATTGG + Intergenic
1156117911 18:33809255-33809277 CTTTACTTTGAGAATCTGGTAGG - Intergenic
1158757783 18:60347557-60347579 CTAATCATGGAGAATCTGATAGG + Intergenic
1160488957 18:79320657-79320679 CTGCATATGGACCATCTGGTTGG + Intronic
1161637114 19:5395849-5395871 CTTGACAGGGAAAATCTGGAGGG + Intergenic
1163087775 19:14994619-14994641 CCTGCCTTGGAGAATCTGGTGGG + Intronic
1165252492 19:34551638-34551660 CTTCATCAGGAGAATCTGGTGGG + Intergenic
1166052267 19:40267382-40267404 CATAACATGGAGAGTCAGGTAGG - Intronic
1168173605 19:54607551-54607573 CTACCCATGGAGATGCTGGTGGG + Intronic
1168639217 19:58019735-58019757 GTTCATATGGAGATTCTGGGAGG - Intergenic
926356341 2:12044094-12044116 ATTCACATGGAAACTCTGGGAGG + Intergenic
926962378 2:18372419-18372441 CCTCACTTTGAGAACCTGGTGGG - Intergenic
927305746 2:21570593-21570615 TTTCACTGTGAGAATCTGGTAGG + Intergenic
927742250 2:25582016-25582038 CTTCACATTAAGAAAGTGGTGGG - Intronic
928187131 2:29121403-29121425 CTTCTAATGGAAAATCTGGAAGG - Exonic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
931081191 2:58773099-58773121 CTTTCTATAGAGAATCTGGTAGG + Intergenic
931385372 2:61793574-61793596 CTTCACCTGGAGCATCAGGGCGG - Intergenic
932932713 2:76061366-76061388 CTTCACAAGGAAAATTTGCTTGG + Intergenic
933527122 2:83455866-83455888 GTTAACATGGATAATCTGGATGG + Intergenic
934687132 2:96329420-96329442 CTTCACAAGGACAATCTTTTTGG + Exonic
935420598 2:102865217-102865239 GTGCACATGGAGAAGGTGGTTGG + Intergenic
935856734 2:107282565-107282587 CTTTACCCTGAGAATCTGGTGGG + Intergenic
935890771 2:107675308-107675330 CTGCACTGTGAGAATCTGGTAGG + Intergenic
936068804 2:109351744-109351766 CTTCACATGGCACACCTGGTAGG - Intronic
936111921 2:109671545-109671567 CTTCTCCTGGAGAATCTGGAGGG + Intergenic
936794998 2:116194254-116194276 GCTCTCATGGAGAATCTGCTAGG - Intergenic
938208945 2:129448586-129448608 CTTCACTGTGAGAACCTGGTGGG - Intergenic
941704011 2:168638341-168638363 ATTCACATTAAGAAACTGGTTGG + Intronic
942541234 2:177017507-177017529 CTTCACTTGGAGGCTATGGTTGG - Intergenic
943286718 2:186010418-186010440 CTTCTCATGGAGTATCTTATTGG - Intergenic
946149029 2:217751602-217751624 CTTGCCATGGAGCATCTAGTGGG - Intronic
946559399 2:220896067-220896089 CTTCATATAGAGAAGGTGGTAGG + Intergenic
946722347 2:222623118-222623140 TTTCAAATGGTCAATCTGGTGGG + Intronic
1169718444 20:8645399-8645421 CTTCTCTTGGAGAATTTTGTAGG + Intronic
1170435230 20:16319748-16319770 CTTCACAGTGAGAACCTGGTGGG - Intronic
1170515624 20:17127203-17127225 CTTCACTATGAGAACCTGGTGGG + Intergenic
1171201170 20:23243584-23243606 CTCCACATGGGGACTGTGGTGGG + Intergenic
1173472095 20:43332156-43332178 CTTCCCAAGAAGGATCTGGTGGG + Intergenic
1173680254 20:44874349-44874371 CTTCACTGTGAGAAACTGGTGGG - Intergenic
1176741115 21:10603090-10603112 AGTCACATGGAGAAACTGGGAGG + Intronic
1180875786 22:19174689-19174711 GTTCACATGGAGTTTCTGGCTGG + Intergenic
1181285388 22:21748303-21748325 CTTCACTATGAGAACCTGGTGGG - Intergenic
1182697709 22:32207601-32207623 CTTCTCCTGCAGAATCTGGAGGG + Intergenic
1183507991 22:38220042-38220064 AGTCACCTGGAGAAGCTGGTAGG - Exonic
1184517826 22:44973620-44973642 ATTCACTTGGAGACCCTGGTGGG - Intronic
1184744470 22:46448225-46448247 CATTACATGGAGACTCTGGCAGG + Intronic
1184944778 22:47795495-47795517 CTTCACATGGAGAGCCTTGCTGG - Intergenic
1185074862 22:48677742-48677764 CCTCACAAGGAGAGTCAGGTCGG + Intronic
950865162 3:16182950-16182972 CTTGAGATGGAGGATCTGGCAGG + Intronic
951036797 3:17941406-17941428 CTTTACTTGGAGAAACTGGGAGG + Intronic
953976653 3:47386558-47386580 CATCCCATGGAAAATCTGGAAGG - Intronic
955591579 3:60541470-60541492 CCCCACATGTAGAATATGGTGGG - Intronic
955595502 3:60586004-60586026 CTTCTCATGGAGAATCTCATTGG + Intronic
956256625 3:67290202-67290224 CATCCCATGGAGAATATGGATGG - Intergenic
956299347 3:67753057-67753079 CTTCACCATGAAAATCTGGTGGG - Intergenic
956707655 3:72013122-72013144 CTTCACTGCGAGAAGCTGGTAGG - Intergenic
957911379 3:86623627-86623649 CTTCTAATGGTGAATCTGGGAGG + Intergenic
958817360 3:98930313-98930335 CTTCTCATGGAGTATCTGACTGG - Intergenic
959126857 3:102300288-102300310 CTTCACTAAAAGAATCTGGTAGG - Intronic
959405074 3:105951492-105951514 CTTCACTATGAGAATCTGGTGGG + Intergenic
960226220 3:115172328-115172350 CATCACAGGGATAATGTGGTAGG + Intergenic
960502302 3:118453058-118453080 CTTCTCATGGAGTATCTTGCTGG + Intergenic
961302866 3:125933459-125933481 CTTCTCATTGAGACTGTGGTGGG + Intronic
961795628 3:129406844-129406866 CTTCATTTGGAGATTTTGGTGGG + Intronic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
964427822 3:156571674-156571696 CTTTCCAAGGAGAATATGGTGGG - Intergenic
965768058 3:172152553-172152575 CTTCCCATGGAGAATGTGAGTGG - Intronic
967316749 3:188157195-188157217 ATTCAAATGGAGTATCTGATTGG - Intronic
968696506 4:2032397-2032419 CTTCTCATGGAGTATCTTATTGG + Intronic
969965868 4:10994967-10994989 CTTCACTTACAGAATCTGATGGG + Intergenic
970503180 4:16699560-16699582 ATTCACATGGAGAATATGTGAGG + Intronic
972384380 4:38550494-38550516 CATCACATGGAAAACATGGTAGG - Intergenic
973710335 4:53623641-53623663 CTTCAAATTGAGAATTTGATTGG - Intronic
973800280 4:54470802-54470824 CATGACCTTGAGAATCTGGTGGG + Intergenic
974540502 4:63227092-63227114 CTTCACAGTGAGAATCTTGTGGG + Intergenic
974602382 4:64101029-64101051 TTTCACACGGATTATCTGGTTGG + Intergenic
975661975 4:76697284-76697306 CTTCTCATTTAGAGTCTGGTGGG + Intronic
975943604 4:79677746-79677768 AATCAAATGGTGAATCTGGTGGG + Intergenic
977084287 4:92574810-92574832 CTTCTCATGGAGTATCTTATTGG + Intronic
977116564 4:93035895-93035917 CTTCACCTTGAGATTCTGCTGGG - Intronic
977414900 4:96720814-96720836 CTTCTCATGGAGTATCTTATTGG + Intergenic
977502114 4:97853714-97853736 CTTCTCTTGAAGAATTTGGTAGG + Intronic
978218488 4:106238973-106238995 CTTCACCCTGAGAACCTGGTGGG - Intronic
979197674 4:117940251-117940273 CTTCACATGGAGTATCTCAACGG + Intergenic
981505690 4:145496816-145496838 CTTCAAAGGGAGAAAGTGGTAGG - Intronic
982799011 4:159679689-159679711 CTTCTCATTGAGAATCTGATAGG - Intergenic
983016742 4:162622672-162622694 CTTCACAGTGAGAATTTGATAGG + Intergenic
983350446 4:166580943-166580965 GTACACATGGAGAATCTGTTTGG - Intergenic
986831768 5:11588219-11588241 CTTCACATGGTGACTCTGGTTGG + Intronic
990287017 5:54310427-54310449 CTGTACATGGATTATCTGGTAGG - Exonic
991084611 5:62637041-62637063 CTTCACAATGAGAAACTGGTGGG + Intergenic
992265797 5:75017284-75017306 CTTCACCCTGAGAATTTGGTGGG + Intergenic
993547643 5:89231575-89231597 CTTCGCTGTGAGAATCTGGTGGG + Intergenic
994751121 5:103738143-103738165 CTTCTCATGCAGAATGTGATTGG + Intergenic
994775208 5:104030978-104031000 CTTCAGAGGGAGAATATGATAGG + Intergenic
994944258 5:106364832-106364854 TTTCACTTGTAGAATCAGGTTGG + Intergenic
995255736 5:110044467-110044489 CTTCTCATGGAGTATCTTATGGG + Intergenic
995377146 5:111487825-111487847 TTTCACATTGAGGAGCTGGTGGG + Exonic
995641903 5:114266828-114266850 CTTTACAAGGAGATGCTGGTGGG - Intergenic
996511024 5:124316177-124316199 CTTCACATGGACCATCAGATAGG + Intergenic
996987740 5:129587592-129587614 GTTCACATGGAGATTCTGTTCGG + Intronic
997873134 5:137522848-137522870 CTTCACTGTGAGAACCTGGTAGG - Intronic
1000379128 5:160613183-160613205 CTTCACCTGGAAAATCAGGGTGG + Intronic
1002084710 5:176766600-176766622 CTTCACTTTGAGAACCTGGCAGG + Intergenic
1003640843 6:7873946-7873968 CTTCACAAGCAGAATGAGGTTGG + Intronic
1006560269 6:34905157-34905179 CATCACATGATGAATCTGGCTGG + Intronic
1008109705 6:47478417-47478439 CTTCTCACGGAGAAACTGGTGGG + Intronic
1008948230 6:57123462-57123484 GTTCACATGGAGAATAAGTTGGG + Intronic
1011007019 6:82656950-82656972 GTTCACCTGGAGGATGTGGTGGG - Intergenic
1011292845 6:85794337-85794359 CTCCATTTGGAGAATCTAGTAGG + Intergenic
1011875010 6:91948696-91948718 TTTCTCTTGGAGAATCTGGAGGG - Intergenic
1021031260 7:15739369-15739391 CTTCACGCTGAGAACCTGGTGGG - Intergenic
1021277718 7:18675329-18675351 CTTCACATGGAGTTGCTAGTAGG - Intronic
1022634816 7:32121382-32121404 CTTCTCATGGAGTATCTTGGTGG - Intronic
1023877559 7:44295627-44295649 CTTCGCTGTGAGAATCTGGTAGG - Intronic
1024084927 7:45884989-45885011 CTTGAGATGGAGAAGCTGGAAGG + Intergenic
1024370375 7:48576398-48576420 CTTCACATGGAGAATCTGGTAGG - Intronic
1026923459 7:74173228-74173250 TTTGAGATGGAGAATCAGGTTGG - Intergenic
1031414598 7:121480366-121480388 CTTCACCAGGCGAATCTGGCTGG - Intergenic
1031634535 7:124085996-124086018 ATTCACATGGAGATTTGGGTGGG - Intergenic
1032507590 7:132447332-132447354 CTTCCCATTGAGAATCTTGAAGG - Intronic
1032807642 7:135373048-135373070 TTACACAGGGAGAATCTGATGGG + Intronic
1033791727 7:144798431-144798453 CTTCTCATGGAGTATCTTATTGG - Intronic
1033873963 7:145791933-145791955 CGTTACAATGAGAATCTGGTTGG + Intergenic
1035149321 7:156854396-156854418 CTTTACTCTGAGAATCTGGTAGG - Intronic
1035734875 8:1880946-1880968 CCTCACATGCAGCATCTGGCTGG + Intronic
1036456032 8:8908792-8908814 TGTCACATGGATAATCTGTTAGG + Intergenic
1040949819 8:52926104-52926126 CTTCATAGTGAGAACCTGGTGGG + Intergenic
1042374904 8:68039253-68039275 CTTCTTATGGAGATTCTGATAGG - Intronic
1042489697 8:69382812-69382834 CTTCTCATGGAGTATCTTATTGG - Intergenic
1043276569 8:78403573-78403595 TTTCAAATGGAAAGTCTGGTTGG - Intergenic
1044377962 8:91498840-91498862 CTTCTCATGGAGTATCTGAGTGG + Intergenic
1045707408 8:104942086-104942108 CTTCACATTGGGAACTTGGTGGG + Intronic
1047895694 8:129363982-129364004 CTTCAGATGGAAAAGCTGGGGGG + Intergenic
1050104851 9:2155107-2155129 CTTCACATTTATAATTTGGTAGG + Intronic
1050176906 9:2877779-2877801 CTTTATATGGAGATTCTGGCAGG + Intergenic
1050500971 9:6296996-6297018 CTTCTCAAGGAGTATCTTGTTGG - Intergenic
1051122074 9:13762198-13762220 CTTGCCATGGAGAGGCTGGTCGG + Intergenic
1052386500 9:27829467-27829489 ATTCCCAAGGAGAATCTGGAAGG + Intergenic
1055658923 9:78481693-78481715 TTTCACAGTGAGAACCTGGTAGG + Intergenic
1057667858 9:97060821-97060843 CTCCAAATGGGGAATTTGGTGGG - Intergenic
1057695148 9:97317883-97317905 CTTTCCATGCAGTATCTGGTTGG - Intronic
1057876001 9:98755017-98755039 CTCCACATAGAAAATATGGTTGG + Intronic
1057899601 9:98937996-98938018 CTTGACTTGTAGAGTCTGGTAGG + Intergenic
1060470916 9:123947499-123947521 CCTCACATGGAGCACCAGGTGGG + Intergenic
1060868778 9:127022442-127022464 CCTCACATGGAGTGTTTGGTAGG - Intronic
1060975221 9:127761310-127761332 CTTTACATGGAGACACTGTTGGG + Intronic
1061979980 9:134096813-134096835 CTTCAAAAGGAGATTCTGGCTGG + Intergenic
1062029063 9:134353816-134353838 CTTCAGGCTGAGAATCTGGTGGG + Intronic
1186629513 X:11334148-11334170 CTTCACATGGAGGATAAGGGAGG - Intronic
1187704226 X:21993632-21993654 CCTCACATGGAGGATCTAGAGGG - Intronic
1187973589 X:24683089-24683111 CCTCACAGTGAGAATCTGGTGGG - Intergenic
1188043118 X:25393587-25393609 CTTCACCGTGAGAACCTGGTGGG + Intergenic
1188572303 X:31602675-31602697 CTTCACATGCTGAATCTGGAAGG + Intronic
1189518985 X:41745777-41745799 CTTCACATTGAAAATCTGCAGGG + Intronic
1189523974 X:41800313-41800335 CTTCAGAGGGAGGATCTGGGTGG + Intronic
1191005188 X:55703398-55703420 CTTCAGATGGAGACTCTGAGTGG - Intergenic
1191078735 X:56486287-56486309 CTTCTCATGGAGTATCTTGCTGG + Intergenic
1191094485 X:56659863-56659885 CTTCTCATGTAGAATCTTGCAGG + Intergenic
1191185381 X:57606233-57606255 CTTCTCATGGAGTATCTTATTGG + Intergenic
1192841487 X:74861499-74861521 CTTCTCATGGAGTATCTTATTGG - Intronic
1193261526 X:79412188-79412210 ATTCACATGAAGGATGTGGTAGG - Intergenic
1194183259 X:90738908-90738930 CTTCTCATGGAGTATCTTATTGG - Intergenic
1195251292 X:103050835-103050857 CTTCACTGTGAGAAACTGGTAGG + Intergenic
1195421795 X:104683828-104683850 CTTCTCATGGAGATTGAGGTGGG + Intronic
1195812830 X:108852838-108852860 CTTCTCATGGAGTATCTTATTGG - Intergenic
1196932889 X:120698403-120698425 CTTCTTGTGGAGAATCTTGTAGG - Intergenic
1196939783 X:120763685-120763707 CCTCACCTTGAGAACCTGGTGGG - Intergenic
1197034375 X:121856015-121856037 CTTCACAGTGAGAACATGGTAGG + Intergenic
1197127913 X:122969836-122969858 AATCCCATGGAGAATCTGTTTGG + Intergenic
1197473616 X:126892966-126892988 CTTCACTGTGAGAACCTGGTAGG - Intergenic
1199065087 X:143406544-143406566 CTGGACATGGAGAATCTGGTAGG + Intergenic
1199963349 X:152797156-152797178 CTTCACTGCGAGAATATGGTGGG + Intergenic
1201390013 Y:13487912-13487934 CTTCTCATGGAGTATCTTGGTGG + Intergenic