ID: 1024371929

View in Genome Browser
Species Human (GRCh38)
Location 7:48595658-48595680
Sequence CCATTAGTCCAATAGAAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024371929_1024371932 -6 Left 1024371929 7:48595658-48595680 CCCAGTTTCTATTGGACTAATGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1024371932 7:48595675-48595697 TAATGGATGCCTGCACACAGAGG No data
1024371929_1024371935 13 Left 1024371929 7:48595658-48595680 CCCAGTTTCTATTGGACTAATGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1024371935 7:48595694-48595716 GAGGAGAGGAATGCCAAATCTGG 0: 1
1: 0
2: 2
3: 14
4: 177
1024371929_1024371933 -1 Left 1024371929 7:48595658-48595680 CCCAGTTTCTATTGGACTAATGG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1024371933 7:48595680-48595702 GATGCCTGCACACAGAGGAGAGG 0: 1
1: 1
2: 9
3: 64
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024371929 Original CRISPR CCATTAGTCCAATAGAAACT GGG (reversed) Intronic
907146877 1:52242691-52242713 CCATCAGTACATAAGAAACTAGG - Intronic
907723532 1:56997074-56997096 CCATTGTTCCATTAGAAAGTTGG + Exonic
910495959 1:87827517-87827539 CCATTATACCAATAAAAAATGGG - Intergenic
911981715 1:104577538-104577560 ACATTAGACCACTAGAAATTGGG - Intergenic
913524230 1:119675907-119675929 ACATTGGTCCATTAGAAGCTGGG + Intronic
917051993 1:170935276-170935298 CCAACAGTCCAGTAGAAGCTGGG - Intergenic
917060960 1:171038784-171038806 CCATTAGTTCAAGAGATGCTTGG + Intronic
918279803 1:182993334-182993356 CCATCAGACCAAAAGAATCTTGG - Intergenic
918415025 1:184297714-184297736 CAATTAGTCCAAGATAAACACGG - Intergenic
1063238394 10:4142927-4142949 CAAATAGTCCAATAGAAAAATGG - Intergenic
1067299530 10:44996185-44996207 CCCTTAGTCCCATGGAAACAAGG + Intergenic
1067955763 10:50788756-50788778 ACATTTGTAAAATAGAAACTTGG + Intronic
1078710305 11:13784629-13784651 CAATTAGTTCAAGAGAAAATTGG - Intergenic
1081496926 11:43621197-43621219 CCATTAGTACTATGGGAACTAGG - Intronic
1088032158 11:105264423-105264445 CAATTAGTCCATTAGTAAATAGG - Intergenic
1088847912 11:113683098-113683120 CCATGGGAGCAATAGAAACTGGG - Intergenic
1089758584 11:120706322-120706344 CCAGGAGTCCAGAAGAAACTGGG - Intronic
1090509739 11:127362637-127362659 CCATAAGTAAAATAGGAACTTGG + Intergenic
1090913811 11:131144890-131144912 CCAATACTCCAAAAGAAATTTGG - Intergenic
1093019541 12:14190467-14190489 CCATTTGTCCATTAAAAAGTTGG + Intergenic
1100056599 12:90518878-90518900 CCATTAGTGGAAAATAAACTTGG + Intergenic
1100621756 12:96283189-96283211 ACATTAGTCCTCTTGAAACTTGG - Intronic
1101174369 12:102134034-102134056 ACATTACACCAAAAGAAACTAGG + Intronic
1101684388 12:107003104-107003126 TCATTAGCACAATAGAAAATAGG - Intronic
1108784630 13:53881160-53881182 CCATTTTTCCAAGAGAAATTTGG + Intergenic
1109149046 13:58821629-58821651 CCAATAGTCCATTAGTAAATCGG - Intergenic
1110430817 13:75421112-75421134 TCATTTCTCCAAAAGAAACTAGG - Intronic
1111314142 13:86529828-86529850 CAATTATTCCAATAGAAAAATGG - Intergenic
1126137686 15:45408099-45408121 CCAACAGTCCAAGAGAAAATGGG + Intronic
1137670916 16:50278405-50278427 CCAATAGCCCAATAGAAAAATGG - Intronic
1138079976 16:54081358-54081380 ACATAAGTCCAAGAAAAACTGGG - Intronic
1138871949 16:60901037-60901059 CCACTAATGCAATAGAAACAAGG - Intergenic
1153209069 18:2739258-2739280 CTATTAATCCAAAAGAAAATAGG - Intronic
1154948164 18:21182872-21182894 GCATTAGTTCTGTAGAAACTGGG + Intergenic
1158637731 18:59176344-59176366 TCATTCCTCCAGTAGAAACTTGG + Intergenic
1161727365 19:5937519-5937541 CCATGAGTCCATTAGAAAAAAGG - Intronic
1162669389 19:12242075-12242097 TCATTAGTCCAAAAAAAAATTGG - Intronic
926359797 2:12076042-12076064 TCATTTGTCCATTAGACACTTGG + Intergenic
926445937 2:12943088-12943110 CAATGAGTCCAATGGATACTAGG + Intergenic
931774486 2:65528757-65528779 CCATTAGTCCAAGGGAAAACTGG - Intergenic
936810101 2:116388180-116388202 CCATTAGGCCAAGAGATACTGGG + Intergenic
939433282 2:142139478-142139500 CCATTTGTCAAATGGATACTTGG - Intergenic
939888129 2:147703569-147703591 CCATCAGTCCCATTCAAACTTGG + Intergenic
941294546 2:163720001-163720023 CCAGTTGTCCAACAGAAAATGGG + Intronic
942085725 2:172442050-172442072 ACATTTCTCCATTAGAAACTAGG + Intronic
942710460 2:178829179-178829201 CAATTAGCACAATAAAAACTGGG - Intronic
943405384 2:187476686-187476708 CCATTACTCAAATAGAAAAAAGG + Intronic
944074393 2:195711958-195711980 CCACTAAGCCGATAGAAACTGGG - Intronic
1169578973 20:6997458-6997480 GCATTAGTTTAAGAGAAACTGGG + Intergenic
1172602181 20:36191370-36191392 CCATCAATCCAATAGAAATGGGG - Intronic
1174187829 20:48719661-48719683 ACAATTGTCCAATAGAAAATGGG + Intronic
1174773513 20:53322997-53323019 CCCTTAGTCCCAGATAAACTGGG - Intronic
1179662053 21:42882651-42882673 CCATTAGCACAATAGAAAAATGG + Intronic
1179930335 21:44567166-44567188 CCATTAATCCACGAAAAACTGGG + Intronic
949760882 3:7469171-7469193 CCATTCATCCAATAGGCACTGGG - Intronic
951834550 3:26967728-26967750 CCAATAATCCAATAAAAAATGGG - Intergenic
953171216 3:40509541-40509563 CCATTAATCCTATGGAAAATAGG - Intronic
958697044 3:97541029-97541051 ACATAAGACCATTAGAAACTTGG - Intronic
962194172 3:133344185-133344207 TCCTTAGTGCAATAAAAACTAGG + Intronic
963109667 3:141676989-141677011 CAAATAATCCAATAGAAACATGG + Intergenic
965962668 3:174447245-174447267 CCATTAATCCCCTAGAGACTAGG - Intronic
967734965 3:192942236-192942258 CCCTTAGTCCAACAGATAATGGG + Intergenic
974779303 4:66530371-66530393 CCATGTGTCCAATAGAAGTTAGG - Intergenic
975056244 4:69934048-69934070 CCTGTAGTCCCAGAGAAACTTGG + Intronic
976826534 4:89266574-89266596 CCCTTAATGCAATAGCAACTTGG - Intronic
976889190 4:90024386-90024408 CCATAAGTCCAACAGAAAAATGG - Intergenic
977864458 4:102007363-102007385 ACATTTGTCAAATAGCAACTGGG + Intronic
980652187 4:135732477-135732499 ACATTTGCCCCATAGAAACTAGG - Intergenic
982431692 4:155329826-155329848 CCTTTAGTCCTATATAAAATGGG - Intergenic
983416786 4:167466846-167466868 GCATTAGTCCCACAGAGACTGGG + Intergenic
985036623 4:185846910-185846932 CTATTTGTCAAATAAAAACTAGG + Intronic
986110012 5:4705849-4705871 CAATTAGTCAAACAGAAACTTGG - Intergenic
986574949 5:9202349-9202371 CCAATAGTCCTATAGGAACCAGG - Intronic
992668045 5:79030862-79030884 CCAGTAGTCTAATGGAATCTTGG + Exonic
995761800 5:115570563-115570585 CTAATAATCCAATAGAAACTTGG + Intergenic
996200262 5:120663876-120663898 CCTTTAGTCCACTTGAAAATGGG - Intronic
1001066696 5:168540485-168540507 CCATTTGTCCAATACAAAGAGGG + Intergenic
1002816058 6:681584-681606 CCTTTAGTCCTATAAAAACTAGG + Intronic
1004857074 6:19762132-19762154 TTATTAGTAGAATAGAAACTTGG + Intergenic
1012079946 6:94744291-94744313 CCATAAGGCAAATAGATACTGGG - Intergenic
1021110682 7:16691287-16691309 CCCTAAGTCCACTAGAAAGTAGG - Intronic
1021477146 7:21075002-21075024 CCATTATTACAAAAAAAACTGGG - Intergenic
1023789581 7:43742646-43742668 CCAAAAATCCAATACAAACTTGG + Intergenic
1024371929 7:48595658-48595680 CCATTAGTCCAATAGAAACTGGG - Intronic
1029442983 7:100597932-100597954 CCATGAGTTCAATATAAGCTTGG - Intronic
1029516728 7:101028543-101028565 GCAATAATCCAATAGAAACATGG - Intronic
1030959751 7:115902478-115902500 CAAATAGTATAATAGAAACTTGG + Intergenic
1031603171 7:123737991-123738013 CAAATAATCCAATAGAAAATTGG + Intronic
1031650752 7:124286701-124286723 CTATTAGCACAATAGAAATTTGG + Intergenic
1033911155 7:146264542-146264564 CCATTAGTCTAATAAATAGTTGG + Intronic
1038071453 8:24018607-24018629 AGATTAGTCCCAGAGAAACTAGG - Intergenic
1038501300 8:28046456-28046478 CCATGAGTGCAATAGAAGCCCGG - Intronic
1041481506 8:58325390-58325412 CCATTACTCCAAAAGAAAATTGG + Intergenic
1048621270 8:136135187-136135209 CCAATAGTCCTATAGACAGTTGG + Intergenic
1050378188 9:4995203-4995225 CCACAAATCCAATAGAAAGTGGG - Intronic
1050988592 9:12115773-12115795 CCATTAGTTAAATAAAAACAAGG - Intergenic
1051229143 9:14935771-14935793 CCATTATACAAATTGAAACTTGG + Intergenic
1055520660 9:77077616-77077638 CCATTCATCCAAAAGACACTTGG - Intergenic
1056705590 9:88950037-88950059 TCATTAGGCCAATAAAAGCTGGG + Intergenic
1058678171 9:107419120-107419142 CCAATAATTCAATAGAAAATTGG - Intergenic
1061998632 9:134204359-134204381 CCATCAGTGCAATATAAACAAGG - Intergenic
1186932530 X:14410646-14410668 CCATTATTACACTAGAAAATGGG - Intergenic
1187787420 X:22907691-22907713 CTAATAGTCCAATAAAAACATGG - Intergenic
1188000287 X:24974089-24974111 CCATGTGTCCAATAAATACTAGG - Intronic
1188773670 X:34186728-34186750 CCAATAATCCAATAAAAAATGGG - Intergenic
1191858416 X:65646152-65646174 CCTTTTGTTCAATAAAAACTGGG + Intronic
1192759634 X:74083604-74083626 CCACTTGTCCAACAGAATCTTGG - Intergenic
1196056324 X:111359675-111359697 CAAACAGTCCAATAGAAAATGGG + Intronic
1197825485 X:130585608-130585630 CAATTCTTCCAATAAAAACTTGG + Intergenic