ID: 1024372533

View in Genome Browser
Species Human (GRCh38)
Location 7:48603107-48603129
Sequence TCTCAGCTTTAGGAGATTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024372529_1024372533 0 Left 1024372529 7:48603084-48603106 CCTGAGACTTTGCTTGAGTTGCC 0: 1
1: 3
2: 997
3: 11522
4: 4660
Right 1024372533 7:48603107-48603129 TCTCAGCTTTAGGAGATTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024372533 Original CRISPR TCTCAGCTTTAGGAGATTTA GGG Intronic
No off target data available for this crispr