ID: 1024376500

View in Genome Browser
Species Human (GRCh38)
Location 7:48644733-48644755
Sequence TAACCAAACCACTTTGGAGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 174}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024376497_1024376500 5 Left 1024376497 7:48644705-48644727 CCTTCTTGAATATTAAGCATTAT 0: 1
1: 0
2: 1
3: 37
4: 312
Right 1024376500 7:48644733-48644755 TAACCAAACCACTTTGGAGCAGG 0: 1
1: 0
2: 0
3: 11
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024376500 Original CRISPR TAACCAAACCACTTTGGAGC AGG Exonic
900133601 1:1103270-1103292 TCAAAAAAGCACTTTGGAGCAGG - Intronic
904909823 1:33926338-33926360 TTACCAAACCACTATCAAGCAGG - Intronic
906274212 1:44504305-44504327 TAACCAAAAGACTTAGGTGCTGG - Intronic
907379984 1:54078956-54078978 TAGCAAAACGCCTTTGGAGCTGG + Intronic
909823026 1:80089880-80089902 TAACCAAAACAGTATGGTGCTGG - Intergenic
911070375 1:93827510-93827532 GGACCAAAGCATTTTGGAGCTGG + Intronic
911252114 1:95588583-95588605 TAACCAAAGCAGTATGGTGCTGG + Intergenic
911665835 1:100550273-100550295 TAACCAAAACAGTTTGGTACTGG - Intergenic
911964391 1:104348238-104348260 GAACCAAATTACTTTAGAGCAGG + Intergenic
911970477 1:104429153-104429175 TAACCAAAACACTGTGGTACTGG - Intergenic
914512802 1:148348969-148348991 TAACCAAAACAGTATGGAGTTGG + Intergenic
914919130 1:151835817-151835839 TAACCATAGTACTTTGGACCAGG - Intergenic
915967338 1:160322227-160322249 TAACCAAAACACTGTGGTACTGG + Intronic
917446592 1:175110741-175110763 TAACCAAAACAGCTTGGACCTGG - Intronic
918713767 1:187764385-187764407 TTGCCAAACCACTATGGAGATGG + Intergenic
920317883 1:205092208-205092230 GATCCAAACCACTCTGCAGCTGG + Intronic
922135492 1:222821344-222821366 TAACCAATTATCTTTGGAGCTGG - Intergenic
922138110 1:222852501-222852523 TAAGAAAACAACTTTGGTGCCGG - Intergenic
923090508 1:230736978-230737000 TAAGCCAACCACCCTGGAGCTGG + Intergenic
1063743548 10:8853739-8853761 AAACCAAACCAGTTTGGTGCTGG - Intergenic
1066153299 10:32648202-32648224 TAACCAAAACAGTTTGGTACTGG - Intronic
1069461602 10:68600043-68600065 GAACCACACCTCTTTGCAGCAGG - Intronic
1070835469 10:79444902-79444924 TCCCCCAACCCCTTTGGAGCAGG + Intronic
1071126524 10:82341950-82341972 TAACCAAAACACCATGGTGCTGG - Intronic
1074960659 10:118442401-118442423 TAACCAAACGTCTGTGGAGATGG - Intergenic
1075026647 10:118989824-118989846 TAATCAAACCAGTGTGGAACTGG + Intergenic
1075456854 10:122590450-122590472 AAACTTAATCACTTTGGAGCTGG + Intronic
1076366388 10:129923406-129923428 TAACCAAAACAGTGTGGTGCTGG + Intronic
1078254833 11:9649626-9649648 TAACCAAAACAGTTTGGTACTGG - Intergenic
1079978393 11:27122078-27122100 TAACCCAAACACTTAGGAGATGG - Intronic
1080000324 11:27340716-27340738 TAACCATAGCTCTTTGCAGCTGG + Exonic
1081111002 11:39133158-39133180 TAACCAAAACACTACGGTGCTGG - Intergenic
1081245854 11:40765106-40765128 AAACCATATCACTTTGCAGCTGG - Intronic
1084958838 11:72705696-72705718 TGACCACAGCACCTTGGAGCTGG - Intronic
1085571605 11:77563131-77563153 TAACCAAAACAGTATGGTGCTGG - Intronic
1086473104 11:87138385-87138407 TAATGAAATCAATTTGGAGCTGG - Intronic
1086905414 11:92412891-92412913 TAACCATACCACTCTGGTGGTGG - Intronic
1093448011 12:19282075-19282097 TAAAAAAACCACTTTGGGCCGGG - Intronic
1093980841 12:25473451-25473473 TAAGAAGTCCACTTTGGAGCTGG - Intronic
1097456116 12:59800715-59800737 TAACCAAACCAGAATGGTGCTGG + Intergenic
1097660950 12:62430616-62430638 TAACTAAAACACTATGGTGCTGG + Intergenic
1102144843 12:110647219-110647241 TAACCAAAGCCCCTGGGAGCTGG - Exonic
1102609209 12:114096334-114096356 TAACCCCACCACTTTGGGGGAGG - Intergenic
1104564038 12:129864211-129864233 TGAGCAAACCACTTTAGAACTGG + Intronic
1105965954 13:25385045-25385067 TAACTAAAGCCCTTTGGAGACGG - Intronic
1106206245 13:27598162-27598184 TTACCACACCACTTAGGAGTGGG + Intronic
1106762697 13:32882566-32882588 TAACCAAAAAATTATGGAGCTGG + Intergenic
1108790466 13:53963819-53963841 TAACCAAAACAGTTTGGTACTGG - Intergenic
1111577463 13:90175026-90175048 TAACTGAACCCTTTTGGAGCAGG + Intergenic
1112064474 13:95778281-95778303 TAACCAAAGCCCTTTGGTACTGG + Intronic
1112903700 13:104391250-104391272 CAACCAAAGCACTTTGGATGAGG + Intergenic
1112995833 13:105574467-105574489 TATGGAAACCACTTTGGAACTGG + Intergenic
1114136138 14:19853616-19853638 TAACCAAAACAGTTTGGCACTGG - Intergenic
1114997762 14:28378326-28378348 TAGCCAAAGCAGTTTTGAGCAGG + Intergenic
1116601986 14:46937580-46937602 TAACCAAAACAGTATGGTGCTGG + Intronic
1117856100 14:60035715-60035737 TAACCAAAACGCCATGGAGCTGG - Intronic
1123586759 15:21767608-21767630 TAACCAAAACACCATGGTGCTGG + Intergenic
1123623398 15:22210173-22210195 TAACCAAAACACCATGGTGCTGG + Intergenic
1123959751 15:25384780-25384802 TAATCAAAACACTATGGTGCTGG + Intronic
1128385837 15:67147571-67147593 GAACCACAGGACTTTGGAGCTGG - Intronic
1128858809 15:71047062-71047084 TAACCAAAACAGTTTGGTACTGG - Intronic
1130364168 15:83218590-83218612 TAACCAAAGCACCATGGTGCTGG + Intergenic
1131657964 15:94481623-94481645 TAACTAAGCCTCTTTGGGGCAGG - Exonic
1131682534 15:94738923-94738945 TAGCCTAACCACCTTGCAGCAGG + Intergenic
1137070801 16:35903207-35903229 TAACCAAACCACTTCAGCCCTGG - Intergenic
1139173592 16:64661041-64661063 TAACCAAAGCAATCTTGAGCTGG - Intergenic
1150940117 17:69683716-69683738 TAACCAAAACACCATGGTGCTGG - Intergenic
1154460411 18:14578653-14578675 TAACCAAAACAGTTTGGTACTGG - Intergenic
1155128576 18:22905729-22905751 TATCTAAAGAACTTTGGAGCTGG - Intronic
1155403325 18:25461785-25461807 TTACCAGACCTCCTTGGAGCTGG - Intergenic
1159337643 18:67090576-67090598 TAACCAAAACAGCATGGAGCTGG + Intergenic
1163730707 19:18947682-18947704 AAACCAATCCACCATGGAGCTGG - Intergenic
1164390670 19:27817566-27817588 TAACCAAAACAGTATGGTGCTGG - Intergenic
927390882 2:22593993-22594015 TAACCAAAACAGTATGGTGCTGG + Intergenic
928270986 2:29854314-29854336 TAACCAAAACACTTCCCAGCAGG - Intronic
931871049 2:66459966-66459988 AAATCAAACCACTGTGGAGGAGG + Intronic
933058509 2:77704432-77704454 TATCCAAAGCACTTTGGACTCGG + Intergenic
933110236 2:78389694-78389716 TAACCAAAACAGTGTGGTGCTGG - Intergenic
933167548 2:79092965-79092987 TAACCAAACCACTTCAGCCCTGG - Intergenic
938760826 2:134424368-134424390 TAACCAGACCACCTTGAAGCGGG - Intronic
939319830 2:140604689-140604711 CATCCAAACCACTTTGCAACTGG - Intronic
941050504 2:160727572-160727594 TAACCAAACCAGCATGGAACTGG + Intergenic
941192995 2:162410196-162410218 TAACCAAAACAATGTGGAACTGG + Intronic
946452757 2:219795054-219795076 CAACCAAAGCACATGGGAGCTGG + Intergenic
1172818316 20:37708640-37708662 TTACCAACCCACAATGGAGCTGG - Intronic
1177140145 21:17349501-17349523 TAACCAAAACACTATGGTACTGG - Intergenic
1177423103 21:20887420-20887442 TAACCAAAACAACTTGGAACTGG - Intergenic
1177689630 21:24488612-24488634 TAACCAAAACAGCTTGGTGCTGG + Intergenic
1178667140 21:34558223-34558245 TCACCAAACCACTCTGCAGCTGG + Intronic
1179071350 21:38073967-38073989 TAACCAAAACAGTATGGTGCTGG + Intronic
1181873088 22:25918228-25918250 TAACCAAACCACTTTACAGATGG - Intronic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
951756085 3:26093051-26093073 TAACCAAAACAGTATGGACCTGG + Intergenic
955092580 3:55767329-55767351 GAAACATGCCACTTTGGAGCTGG - Intronic
956986849 3:74711547-74711569 TAACCAAATGAATTTGGATCTGG - Intergenic
957779155 3:84796279-84796301 TAACCAAACCAGTGTGGTACTGG + Intergenic
958453965 3:94307115-94307137 GAACCAAACTTCTTTGGTGCTGG + Intergenic
958792757 3:98670831-98670853 TTGCCAAACCTCTTTAGAGCAGG - Intergenic
959427266 3:106206336-106206358 TAACCACACCATTGTGGAGCCGG + Intergenic
960168914 3:114435962-114435984 TAACCAAATCAAATTGTAGCGGG - Intronic
960446726 3:117758366-117758388 TCACCCAACCAATTTGTAGCAGG + Intergenic
960801266 3:121542819-121542841 TAAAAAGACCACTTTGGGGCCGG + Intronic
964323821 3:155525499-155525521 TAACAAAACCACCTTGGACTGGG - Intronic
965647200 3:170896766-170896788 TAAGGAAACAACTTTGGAACTGG + Intronic
965872810 3:173280936-173280958 TAACCAAACCACCTTAGCCCTGG + Intergenic
966948996 3:184798924-184798946 CAACCAGTCCACATTGGAGCAGG - Intergenic
972786155 4:42328511-42328533 ATACCTAAGCACTTTGGAGCTGG + Intergenic
975896682 4:79101056-79101078 TAACCAAAACAGTATGGTGCTGG - Intergenic
976079501 4:81339360-81339382 TAACCAAAACAATATGGTGCTGG - Intergenic
976205382 4:82619070-82619092 TAACCAACCCAGTCAGGAGCAGG + Intergenic
977134848 4:93291125-93291147 TAACCCCAGCACTTTGGATCTGG - Intronic
978006057 4:103618454-103618476 TAACCAAAACAGTTTGGCACTGG - Intronic
979091761 4:116492485-116492507 TAATCCCAGCACTTTGGAGCCGG + Intergenic
983407662 4:167350405-167350427 TAACCAAAACAGTGTGGTGCTGG - Intergenic
986993100 5:13576731-13576753 TAACAAAACCAATTTGTATCTGG - Intergenic
988172685 5:27680151-27680173 TAACCAAAACAGCTTGGTGCTGG + Intergenic
990534822 5:56710700-56710722 TAACCAAAACAGCTTGGTGCTGG + Intergenic
992309961 5:75487099-75487121 TAACCAAAACAGTTTGGTACTGG + Intronic
994585651 5:101705944-101705966 TAACCAAAACAGTATGGTGCTGG - Intergenic
994797402 5:104320557-104320579 TAATAAAACCACTATGGAGCGGG - Intergenic
996059288 5:119015033-119015055 TAACCCTACCTCTTTGGTGCTGG - Intergenic
997734274 5:136201958-136201980 TCTCCAAATCATTTTGGAGCTGG - Intergenic
998728153 5:145042746-145042768 TAACCAAAACAGTATGGTGCTGG + Intergenic
999268960 5:150285330-150285352 TATCCACAGCACTTTGGGGCCGG - Intronic
999465221 5:151796962-151796984 GAACCAAACCACTTTATGGCTGG - Intronic
999498309 5:152122038-152122060 TAACCAAACCTCTTTATAGTTGG + Intergenic
999602376 5:153281627-153281649 TAATCCAAGCACTTTGGAGGCGG - Intergenic
1000217091 5:159170249-159170271 TGACCAAACTGCTATGGAGCAGG + Intronic
1000539737 5:162525441-162525463 TATCCACACCACTTGGGTGCTGG - Intergenic
1007349988 6:41264772-41264794 TAACCAAAACAGTTTGGCACTGG + Intergenic
1007459114 6:42004258-42004280 TAAACATATCACTTTGGACCAGG - Intronic
1009692588 6:67055631-67055653 AAAACATACCACTTTGGTGCTGG - Intergenic
1011230206 6:85152586-85152608 AAACCTAACCAATTTGTAGCTGG + Intergenic
1011349645 6:86408443-86408465 TAATCAGACGACATTGGAGCTGG + Intergenic
1012810130 6:103946571-103946593 TAACCAAAGCACTGTGGTGCTGG - Intergenic
1013115975 6:107104035-107104057 TAACCCCAGCACTTTGGAGGCGG + Intronic
1013385340 6:109624194-109624216 TAACCAATCCAGTTTGGGGTAGG - Intronic
1013471046 6:110465903-110465925 TAACCAAACCAGCATGGAACTGG + Intronic
1013557241 6:111269130-111269152 TAACCTAACAGCTTTGGAGATGG + Exonic
1014560211 6:122880675-122880697 TAACCAAAACACCTTGGTACTGG - Intergenic
1016334763 6:142993069-142993091 TAACCAAAACAGTATGGTGCTGG + Intergenic
1016507267 6:144796338-144796360 AAACCTAACCACTTAGGAGATGG - Intronic
1017994107 6:159516586-159516608 TAACCAAAACACTGTGGTACTGG - Intergenic
1020038697 7:4984719-4984741 TAAACAAACCTGTCTGGAGCCGG - Intronic
1020977270 7:15022135-15022157 TAACCAAAACACTATGCAACGGG + Intergenic
1021023835 7:15639834-15639856 TAACCAAAACAGTTTGGTACTGG - Intronic
1021054278 7:16027533-16027555 TAACAAAACCTCTTTGGATAAGG + Intergenic
1021496605 7:21281678-21281700 TAATGAAAACACTTTGGAGTTGG - Intergenic
1021770008 7:23990051-23990073 TAACCAAAACAATATGGAACTGG + Intergenic
1022182840 7:27939150-27939172 TAACCATATCATTTTGAAGCAGG - Intronic
1022946861 7:35294643-35294665 TTACAAAAACACTTTGGGGCCGG + Intergenic
1024376500 7:48644733-48644755 TAACCAAACCACTTTGGAGCAGG + Exonic
1025140905 7:56463090-56463112 TAATCAAAGCACTTTGGTACTGG - Intergenic
1025240831 7:57271386-57271408 TAATCAAAGCACTTTGGTACTGG - Intergenic
1027583296 7:80024822-80024844 TAACCAAAACAGTTTGGTACTGG + Intergenic
1028920304 7:96303494-96303516 TAACCTAACCACTTAGAAGCAGG + Intronic
1032527819 7:132593250-132593272 TAACCCAACCAGCTTGGAGCTGG - Intronic
1032605802 7:133350545-133350567 TAATCAAAACACTGTGGTGCTGG - Intronic
1034914983 7:155030598-155030620 TAACCAAAGCAGTATGGTGCTGG - Intergenic
1036106671 8:5848260-5848282 TAACCAAAACACTATGGCACTGG + Intergenic
1037124052 8:15323686-15323708 CAACCAAACAAGGTTGGAGCTGG + Intergenic
1037869139 8:22475228-22475250 TTACCACACCACTTTTTAGCTGG - Intronic
1040379090 8:46854899-46854921 TTATTAAATCACTTTGGAGCTGG - Intergenic
1046352223 8:113030394-113030416 TCACCAAAACACTTTGGTACTGG + Intronic
1050790277 9:9459961-9459983 TAACCAAAACACCATGGAACTGG + Intronic
1052421266 9:28246062-28246084 TAACCAAAACACTATGGTACTGG + Intronic
1055141620 9:72883044-72883066 TTTCCAAATCAGTTTGGAGCAGG + Intergenic
1057928529 9:99173292-99173314 TAACCAAACATCTTTGGAATGGG + Intergenic
1187996155 X:24929127-24929149 TAGCCAACCCAATTTGGTGCAGG - Intronic
1188239942 X:27773657-27773679 CAAACAAACCACTTTGCAGTAGG + Intergenic
1189162865 X:38828946-38828968 TAACCAAAACACTGTGGTCCTGG + Intergenic
1189601567 X:42632230-42632252 TAAGAAAACCACTTTGGAGAAGG - Intergenic
1192711626 X:73596644-73596666 TAACCAAAGCAGTTTGGTACTGG + Intronic
1192828512 X:74725448-74725470 TAACCAAAACAGTATGGTGCTGG - Intergenic
1193024713 X:76833587-76833609 TAACCAAACCAGTATGGTACTGG - Intergenic
1193098814 X:77584431-77584453 TAACCAAAACACTATGGTACTGG + Intronic
1193971214 X:88055883-88055905 TAATCAAAACAGTTTTGAGCTGG + Intergenic
1195887272 X:109652777-109652799 TAACAAAACCACCTTGAAGAAGG + Intronic
1196616464 X:117771492-117771514 TTACCAAACCACTTGGGAGAGGG - Intergenic
1196994626 X:121368605-121368627 TAACCAAAACACTATGGTACTGG + Intergenic
1198753967 X:139963679-139963701 TAACCAAAACAGTATGGTGCTGG + Intronic
1200861927 Y:8002218-8002240 TAATCAAAGCACTTTGGTACTGG + Intergenic
1200861959 Y:8002619-8002641 TAATCAAAGCACTTTGGTACTGG + Intergenic
1202255776 Y:22918716-22918738 TAATCAAAGCACTTTGGCACTGG - Intergenic
1202408767 Y:24552465-24552487 TAATCAAAGCACTTTGGCACTGG - Intergenic
1202462016 Y:25117615-25117637 TAATCAAAGCACTTTGGCACTGG + Intergenic