ID: 1024376774

View in Genome Browser
Species Human (GRCh38)
Location 7:48648616-48648638
Sequence TGGGTACTATAAACATGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024376768_1024376774 -3 Left 1024376768 7:48648596-48648618 CCATGCACATAAGTAGGTAGTGG No data
Right 1024376774 7:48648616-48648638 TGGGTACTATAAACATGGGGTGG No data
1024376765_1024376774 24 Left 1024376765 7:48648569-48648591 CCTTCAACTAACACCTTTGATCT No data
Right 1024376774 7:48648616-48648638 TGGGTACTATAAACATGGGGTGG No data
1024376766_1024376774 11 Left 1024376766 7:48648582-48648604 CCTTTGATCTCATTCCATGCACA No data
Right 1024376774 7:48648616-48648638 TGGGTACTATAAACATGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024376774 Original CRISPR TGGGTACTATAAACATGGGG TGG Intergenic
No off target data available for this crispr