ID: 1024378888

View in Genome Browser
Species Human (GRCh38)
Location 7:48671329-48671351
Sequence ATATAGGCACATTGGGGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024378876_1024378888 29 Left 1024378876 7:48671277-48671299 CCTTACCATATGGCCTCATTCAA No data
Right 1024378888 7:48671329-48671351 ATATAGGCACATTGGGGGTTAGG No data
1024378879_1024378888 6 Left 1024378879 7:48671300-48671322 CCTTTACTTACATAAAGAGCCCT No data
Right 1024378888 7:48671329-48671351 ATATAGGCACATTGGGGGTTAGG No data
1024378878_1024378888 16 Left 1024378878 7:48671290-48671312 CCTCATTCAACCTTTACTTACAT No data
Right 1024378888 7:48671329-48671351 ATATAGGCACATTGGGGGTTAGG No data
1024378877_1024378888 24 Left 1024378877 7:48671282-48671304 CCATATGGCCTCATTCAACCTTT No data
Right 1024378888 7:48671329-48671351 ATATAGGCACATTGGGGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024378888 Original CRISPR ATATAGGCACATTGGGGGTT AGG Intergenic
No off target data available for this crispr