ID: 1024380674

View in Genome Browser
Species Human (GRCh38)
Location 7:48692397-48692419
Sequence GTAGTGGCATAATTTAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024380674_1024380679 29 Left 1024380674 7:48692397-48692419 CCAGAACTAAATTATGCCACTAC No data
Right 1024380679 7:48692449-48692471 GATATCTAAGTGATACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024380674 Original CRISPR GTAGTGGCATAATTTAGTTC TGG (reversed) Intergenic
No off target data available for this crispr