ID: 1024380677

View in Genome Browser
Species Human (GRCh38)
Location 7:48692433-48692455
Sequence AGATATCTTCATATAAGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024380677_1024380681 30 Left 1024380677 7:48692433-48692455 CCAGTCCTTATATGAAGATATCT No data
Right 1024380681 7:48692486-48692508 TCCCTTAAGATAATTCAATAAGG No data
1024380677_1024380679 -7 Left 1024380677 7:48692433-48692455 CCAGTCCTTATATGAAGATATCT No data
Right 1024380679 7:48692449-48692471 GATATCTAAGTGATACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024380677 Original CRISPR AGATATCTTCATATAAGGAC TGG (reversed) Intergenic
No off target data available for this crispr