ID: 1024380679

View in Genome Browser
Species Human (GRCh38)
Location 7:48692449-48692471
Sequence GATATCTAAGTGATACTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024380674_1024380679 29 Left 1024380674 7:48692397-48692419 CCAGAACTAAATTATGCCACTAC No data
Right 1024380679 7:48692449-48692471 GATATCTAAGTGATACTGCCTGG No data
1024380676_1024380679 13 Left 1024380676 7:48692413-48692435 CCACTACTATTTTAGGAATACCA No data
Right 1024380679 7:48692449-48692471 GATATCTAAGTGATACTGCCTGG No data
1024380677_1024380679 -7 Left 1024380677 7:48692433-48692455 CCAGTCCTTATATGAAGATATCT No data
Right 1024380679 7:48692449-48692471 GATATCTAAGTGATACTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024380679 Original CRISPR GATATCTAAGTGATACTGCC TGG Intergenic
No off target data available for this crispr