ID: 1024381699

View in Genome Browser
Species Human (GRCh38)
Location 7:48704150-48704172
Sequence GCAGATTCCCTAACCACAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024381699_1024381704 1 Left 1024381699 7:48704150-48704172 CCAGTTGTGGTTAGGGAATCTGC No data
Right 1024381704 7:48704174-48704196 CTGGCCGCAGGGTTGGACTCTGG No data
1024381699_1024381706 7 Left 1024381699 7:48704150-48704172 CCAGTTGTGGTTAGGGAATCTGC No data
Right 1024381706 7:48704180-48704202 GCAGGGTTGGACTCTGGTAATGG No data
1024381699_1024381708 28 Left 1024381699 7:48704150-48704172 CCAGTTGTGGTTAGGGAATCTGC No data
Right 1024381708 7:48704201-48704223 GGTACTTCCTGTCCAGATTAGGG No data
1024381699_1024381702 -10 Left 1024381699 7:48704150-48704172 CCAGTTGTGGTTAGGGAATCTGC No data
Right 1024381702 7:48704163-48704185 GGGAATCTGCTCTGGCCGCAGGG No data
1024381699_1024381703 -6 Left 1024381699 7:48704150-48704172 CCAGTTGTGGTTAGGGAATCTGC No data
Right 1024381703 7:48704167-48704189 ATCTGCTCTGGCCGCAGGGTTGG No data
1024381699_1024381707 27 Left 1024381699 7:48704150-48704172 CCAGTTGTGGTTAGGGAATCTGC No data
Right 1024381707 7:48704200-48704222 TGGTACTTCCTGTCCAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024381699 Original CRISPR GCAGATTCCCTAACCACAAC TGG (reversed) Intergenic
No off target data available for this crispr