ID: 1024383614

View in Genome Browser
Species Human (GRCh38)
Location 7:48726149-48726171
Sequence CAATATGCTGATAATGATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024383614_1024383617 4 Left 1024383614 7:48726149-48726171 CCCATATCATTATCAGCATATTG No data
Right 1024383617 7:48726176-48726198 CAGCCATTCAAAAAATCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024383614 Original CRISPR CAATATGCTGATAATGATAT GGG (reversed) Intergenic
No off target data available for this crispr