ID: 1024387465

View in Genome Browser
Species Human (GRCh38)
Location 7:48769290-48769312
Sequence ATGTGGGTAAAGAGGAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024387458_1024387465 1 Left 1024387458 7:48769266-48769288 CCTCACTTGGCCCTTCTTTGGTG No data
Right 1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG No data
1024387455_1024387465 15 Left 1024387455 7:48769252-48769274 CCTTCTTGTTGTGTCCTCACTTG No data
Right 1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG No data
1024387461_1024387465 -9 Left 1024387461 7:48769276-48769298 CCCTTCTTTGGTGTATGTGGGTA No data
Right 1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG No data
1024387454_1024387465 18 Left 1024387454 7:48769249-48769271 CCTCCTTCTTGTTGTGTCCTCAC No data
Right 1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG No data
1024387462_1024387465 -10 Left 1024387462 7:48769277-48769299 CCTTCTTTGGTGTATGTGGGTAA No data
Right 1024387465 7:48769290-48769312 ATGTGGGTAAAGAGGAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024387465 Original CRISPR ATGTGGGTAAAGAGGAAAGG AGG Intergenic
No off target data available for this crispr