ID: 1024389721

View in Genome Browser
Species Human (GRCh38)
Location 7:48794344-48794366
Sequence GGACTAGGAAGGCCAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024389716_1024389721 15 Left 1024389716 7:48794306-48794328 CCTTGCTAAACTGACTTAGCAGG No data
Right 1024389721 7:48794344-48794366 GGACTAGGAAGGCCAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024389721 Original CRISPR GGACTAGGAAGGCCAAAAGC AGG Intergenic
No off target data available for this crispr