ID: 1024391019

View in Genome Browser
Species Human (GRCh38)
Location 7:48812598-48812620
Sequence TGGTCATCAACACAAGACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024391019 Original CRISPR TGGTCATCAACACAAGACAG GGG (reversed) Intergenic