ID: 1024396813

View in Genome Browser
Species Human (GRCh38)
Location 7:48879006-48879028
Sequence CTGGGTGAGTAACAGGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024396813_1024396822 15 Left 1024396813 7:48879006-48879028 CCTACTTCCTGTTACTCACCCAG No data
Right 1024396822 7:48879044-48879066 CAACCTATTGATGCTCTTGTTGG No data
1024396813_1024396816 -8 Left 1024396813 7:48879006-48879028 CCTACTTCCTGTTACTCACCCAG No data
Right 1024396816 7:48879021-48879043 TCACCCAGCAGGCCCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024396813 Original CRISPR CTGGGTGAGTAACAGGAAGT AGG (reversed) Intergenic
No off target data available for this crispr