ID: 1024402300 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:48939053-48939075 |
Sequence | TGGTATCTAAAAACAGATGA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1024402300_1024402302 | 11 | Left | 1024402300 | 7:48939053-48939075 | CCTTCATCTGTTTTTAGATACCA | No data | ||
Right | 1024402302 | 7:48939087-48939109 | TCCATTTTGTGTTGCCATAAAGG | 0: 8 1: 95 2: 209 3: 486 4: 796 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1024402300 | Original CRISPR | TGGTATCTAAAAACAGATGA AGG (reversed) | Intergenic | ||
No off target data available for this crispr |