ID: 1024402300

View in Genome Browser
Species Human (GRCh38)
Location 7:48939053-48939075
Sequence TGGTATCTAAAAACAGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024402300_1024402302 11 Left 1024402300 7:48939053-48939075 CCTTCATCTGTTTTTAGATACCA No data
Right 1024402302 7:48939087-48939109 TCCATTTTGTGTTGCCATAAAGG 0: 8
1: 95
2: 209
3: 486
4: 796

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024402300 Original CRISPR TGGTATCTAAAAACAGATGA AGG (reversed) Intergenic
No off target data available for this crispr