ID: 1024404815

View in Genome Browser
Species Human (GRCh38)
Location 7:48966496-48966518
Sequence GCTCCTACTCCCAGTGAGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024404812_1024404815 26 Left 1024404812 7:48966447-48966469 CCAGTAGTTGAAAGCAAAACACT No data
Right 1024404815 7:48966496-48966518 GCTCCTACTCCCAGTGAGTTCGG No data
1024404814_1024404815 -1 Left 1024404814 7:48966474-48966496 CCTAAATATGATCTGAGTGAAAG No data
Right 1024404815 7:48966496-48966518 GCTCCTACTCCCAGTGAGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024404815 Original CRISPR GCTCCTACTCCCAGTGAGTT CGG Intergenic
No off target data available for this crispr