ID: 1024409489

View in Genome Browser
Species Human (GRCh38)
Location 7:49023785-49023807
Sequence CTGTGATGACCTTGAGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024409485_1024409489 23 Left 1024409485 7:49023739-49023761 CCCCTATTACAATTATCTATATA No data
Right 1024409489 7:49023785-49023807 CTGTGATGACCTTGAGCATAAGG No data
1024409487_1024409489 21 Left 1024409487 7:49023741-49023763 CCTATTACAATTATCTATATATC No data
Right 1024409489 7:49023785-49023807 CTGTGATGACCTTGAGCATAAGG No data
1024409486_1024409489 22 Left 1024409486 7:49023740-49023762 CCCTATTACAATTATCTATATAT No data
Right 1024409489 7:49023785-49023807 CTGTGATGACCTTGAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024409489 Original CRISPR CTGTGATGACCTTGAGCATA AGG Intergenic
No off target data available for this crispr