ID: 1024414072

View in Genome Browser
Species Human (GRCh38)
Location 7:49081899-49081921
Sequence CTGCTTCCAAAATACAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024414071_1024414072 -10 Left 1024414071 7:49081886-49081908 CCAGGTAAGTTATCTGCTTCCAA No data
Right 1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG No data
1024414069_1024414072 10 Left 1024414069 7:49081866-49081888 CCAGCTGTGAACTTGTGAAACCA No data
Right 1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG No data
1024414067_1024414072 14 Left 1024414067 7:49081862-49081884 CCCTCCAGCTGTGAACTTGTGAA No data
Right 1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG No data
1024414065_1024414072 28 Left 1024414065 7:49081848-49081870 CCTGAGGCAAATTCCCCTCCAGC 0: 8
1: 27
2: 60
3: 106
4: 247
Right 1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG No data
1024414068_1024414072 13 Left 1024414068 7:49081863-49081885 CCTCCAGCTGTGAACTTGTGAAA No data
Right 1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG No data
1024414066_1024414072 15 Left 1024414066 7:49081861-49081883 CCCCTCCAGCTGTGAACTTGTGA No data
Right 1024414072 7:49081899-49081921 CTGCTTCCAAAATACAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024414072 Original CRISPR CTGCTTCCAAAATACAATGC TGG Intergenic
No off target data available for this crispr