ID: 1024417316

View in Genome Browser
Species Human (GRCh38)
Location 7:49121835-49121857
Sequence TTGGGGTCACAGGATGCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024417316_1024417321 5 Left 1024417316 7:49121835-49121857 CCAAAAGCATCCTGTGACCCCAA No data
Right 1024417321 7:49121863-49121885 TCAAACCATCCTTCGTGTAAAGG No data
1024417316_1024417322 6 Left 1024417316 7:49121835-49121857 CCAAAAGCATCCTGTGACCCCAA No data
Right 1024417322 7:49121864-49121886 CAAACCATCCTTCGTGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024417316 Original CRISPR TTGGGGTCACAGGATGCTTT TGG (reversed) Intergenic
No off target data available for this crispr