ID: 1024419416

View in Genome Browser
Species Human (GRCh38)
Location 7:49145037-49145059
Sequence TTTGAGTGCTTAGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024419416_1024419418 21 Left 1024419416 7:49145037-49145059 CCTGTTTTTCCTAAGCACTCAAA No data
Right 1024419418 7:49145081-49145103 ATTATTATTTTCCTTCTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024419416 Original CRISPR TTTGAGTGCTTAGGAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr