ID: 1024423614

View in Genome Browser
Species Human (GRCh38)
Location 7:49199979-49200001
Sequence TCTGTATGTTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024423614_1024423618 13 Left 1024423614 7:49199979-49200001 CCAGCACTCCCTCAACATACAGA No data
Right 1024423618 7:49200015-49200037 TTTTCCTTTGTTTTATGGAATGG No data
1024423614_1024423617 8 Left 1024423614 7:49199979-49200001 CCAGCACTCCCTCAACATACAGA No data
Right 1024423617 7:49200010-49200032 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931
1024423614_1024423619 14 Left 1024423614 7:49199979-49200001 CCAGCACTCCCTCAACATACAGA No data
Right 1024423619 7:49200016-49200038 TTTCCTTTGTTTTATGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024423614 Original CRISPR TCTGTATGTTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr