ID: 1024427764

View in Genome Browser
Species Human (GRCh38)
Location 7:49247347-49247369
Sequence ACTCGGCTACCATTCACGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024427764_1024427769 23 Left 1024427764 7:49247347-49247369 CCCCTCGTGAATGGTAGCCGAGT No data
Right 1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024427764 Original CRISPR ACTCGGCTACCATTCACGAG GGG (reversed) Intergenic
No off target data available for this crispr