ID: 1024427765

View in Genome Browser
Species Human (GRCh38)
Location 7:49247348-49247370
Sequence AACTCGGCTACCATTCACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024427765_1024427769 22 Left 1024427765 7:49247348-49247370 CCCTCGTGAATGGTAGCCGAGTT No data
Right 1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024427765 Original CRISPR AACTCGGCTACCATTCACGA GGG (reversed) Intergenic
No off target data available for this crispr