ID: 1024427767

View in Genome Browser
Species Human (GRCh38)
Location 7:49247364-49247386
Sequence GTAATTGTAATCTGATAACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024427767_1024427769 6 Left 1024427767 7:49247364-49247386 CCGAGTTATCAGATTACAATTAC No data
Right 1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG No data
1024427767_1024427771 23 Left 1024427767 7:49247364-49247386 CCGAGTTATCAGATTACAATTAC No data
Right 1024427771 7:49247410-49247432 TGATGGCCCTCAAAGGAGCAAGG No data
1024427767_1024427770 16 Left 1024427767 7:49247364-49247386 CCGAGTTATCAGATTACAATTAC No data
Right 1024427770 7:49247403-49247425 AATGTTTTGATGGCCCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024427767 Original CRISPR GTAATTGTAATCTGATAACT CGG (reversed) Intergenic
No off target data available for this crispr