ID: 1024427769

View in Genome Browser
Species Human (GRCh38)
Location 7:49247393-49247415
Sequence CTGACTACTGAATGTTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024427766_1024427769 21 Left 1024427766 7:49247349-49247371 CCTCGTGAATGGTAGCCGAGTTA No data
Right 1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG No data
1024427764_1024427769 23 Left 1024427764 7:49247347-49247369 CCCCTCGTGAATGGTAGCCGAGT No data
Right 1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG No data
1024427765_1024427769 22 Left 1024427765 7:49247348-49247370 CCCTCGTGAATGGTAGCCGAGTT No data
Right 1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG No data
1024427767_1024427769 6 Left 1024427767 7:49247364-49247386 CCGAGTTATCAGATTACAATTAC No data
Right 1024427769 7:49247393-49247415 CTGACTACTGAATGTTTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024427769 Original CRISPR CTGACTACTGAATGTTTTGA TGG Intergenic
No off target data available for this crispr