ID: 1024432181

View in Genome Browser
Species Human (GRCh38)
Location 7:49301758-49301780
Sequence GGGGCTGGTGAGTGACATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024432175_1024432181 3 Left 1024432175 7:49301732-49301754 CCATCAACAGAGAAGACTGGTGA No data
Right 1024432181 7:49301758-49301780 GGGGCTGGTGAGTGACATCAGGG No data
1024432174_1024432181 4 Left 1024432174 7:49301731-49301753 CCCATCAACAGAGAAGACTGGTG No data
Right 1024432181 7:49301758-49301780 GGGGCTGGTGAGTGACATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024432181 Original CRISPR GGGGCTGGTGAGTGACATCA GGG Intergenic
No off target data available for this crispr