ID: 1024433959

View in Genome Browser
Species Human (GRCh38)
Location 7:49326972-49326994
Sequence TGTCAATTAGATATTTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024433959_1024433961 -7 Left 1024433959 7:49326972-49326994 CCAGCCAAAATATCTAATTGACA No data
Right 1024433961 7:49326988-49327010 ATTGACAATTGTAAGACAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024433959 Original CRISPR TGTCAATTAGATATTTTGGC TGG (reversed) Intergenic
No off target data available for this crispr