ID: 1024435030

View in Genome Browser
Species Human (GRCh38)
Location 7:49342130-49342152
Sequence AACCATATGAGGCAACTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024435030_1024435035 12 Left 1024435030 7:49342130-49342152 CCCAGGAGTTGCCTCATATGGTT No data
Right 1024435035 7:49342165-49342187 CTGCCCTTTTCCAGAAAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024435030 Original CRISPR AACCATATGAGGCAACTCCT GGG (reversed) Intergenic
No off target data available for this crispr