ID: 1024436194

View in Genome Browser
Species Human (GRCh38)
Location 7:49357755-49357777
Sequence GCTAACTTAGGACCAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024436191_1024436194 11 Left 1024436191 7:49357721-49357743 CCTGTATCTTGCAAAGATACGAG No data
Right 1024436194 7:49357755-49357777 GCTAACTTAGGACCAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024436194 Original CRISPR GCTAACTTAGGACCAAAGAC AGG Intergenic
No off target data available for this crispr