ID: 1024437215

View in Genome Browser
Species Human (GRCh38)
Location 7:49372343-49372365
Sequence TTAGTGTGAGGTTAGCTGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024437211_1024437215 -8 Left 1024437211 7:49372328-49372350 CCAGTCTTTCACTTTTTAGTGTG No data
Right 1024437215 7:49372343-49372365 TTAGTGTGAGGTTAGCTGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024437215 Original CRISPR TTAGTGTGAGGTTAGCTGCG GGG Intergenic
No off target data available for this crispr