ID: 1024438285

View in Genome Browser
Species Human (GRCh38)
Location 7:49384853-49384875
Sequence CAGAAAAAACTTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024438285_1024438289 2 Left 1024438285 7:49384853-49384875 CCCTCCTCCTCAAGTTTTTTCTG No data
Right 1024438289 7:49384878-49384900 ATAAAGATCTTGCATTAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024438285 Original CRISPR CAGAAAAAACTTGAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr