ID: 1024443812

View in Genome Browser
Species Human (GRCh38)
Location 7:49453666-49453688
Sequence CAGCTCCCTCAGCTTGCGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024443797_1024443812 27 Left 1024443797 7:49453616-49453638 CCCACCGCTGCACTGTGGGGGCC No data
Right 1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG No data
1024443799_1024443812 23 Left 1024443799 7:49453620-49453642 CCGCTGCACTGTGGGGGCCCCTT 0: 6
1: 950
2: 605
3: 324
4: 366
Right 1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG No data
1024443798_1024443812 26 Left 1024443798 7:49453617-49453639 CCACCGCTGCACTGTGGGGGCCC 0: 10
1: 669
2: 901
3: 413
4: 295
Right 1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG No data
1024443808_1024443812 -10 Left 1024443808 7:49453653-49453675 CCAAGGCTGGAGCCAGCTCCCTC 0: 31
1: 210
2: 757
3: 809
4: 721
Right 1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG No data
1024443806_1024443812 4 Left 1024443806 7:49453639-49453661 CCTTTCTGGGCTGGCCAAGGCTG 0: 229
1: 528
2: 627
3: 366
4: 470
Right 1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG No data
1024443805_1024443812 5 Left 1024443805 7:49453638-49453660 CCCTTTCTGGGCTGGCCAAGGCT 0: 250
1: 794
2: 496
3: 377
4: 460
Right 1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG No data
1024443804_1024443812 6 Left 1024443804 7:49453637-49453659 CCCCTTTCTGGGCTGGCCAAGGC 0: 904
1: 507
2: 305
3: 311
4: 429
Right 1024443812 7:49453666-49453688 CAGCTCCCTCAGCTTGCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024443812 Original CRISPR CAGCTCCCTCAGCTTGCGGG AGG Intergenic
No off target data available for this crispr