ID: 1024445335

View in Genome Browser
Species Human (GRCh38)
Location 7:49471116-49471138
Sequence TCTCCACTCAGTAAAATGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024445329_1024445335 24 Left 1024445329 7:49471069-49471091 CCAGGTGTTATTTTACTTTGAGG No data
Right 1024445335 7:49471116-49471138 TCTCCACTCAGTAAAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024445335 Original CRISPR TCTCCACTCAGTAAAATGGG TGG Intergenic
No off target data available for this crispr