ID: 1024447005

View in Genome Browser
Species Human (GRCh38)
Location 7:49492439-49492461
Sequence TAATCAACCCCAAGTGGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024447005_1024447011 25 Left 1024447005 7:49492439-49492461 CCTAACCCACTTGGGGTTGATTA No data
Right 1024447011 7:49492487-49492509 GTTGAGTTTATTCTCTTGCCAGG No data
1024447005_1024447010 -10 Left 1024447005 7:49492439-49492461 CCTAACCCACTTGGGGTTGATTA No data
Right 1024447010 7:49492452-49492474 GGGTTGATTATAACGGGCTTTGG No data
1024447005_1024447013 29 Left 1024447005 7:49492439-49492461 CCTAACCCACTTGGGGTTGATTA No data
Right 1024447013 7:49492491-49492513 AGTTTATTCTCTTGCCAGGGTGG No data
1024447005_1024447012 26 Left 1024447005 7:49492439-49492461 CCTAACCCACTTGGGGTTGATTA No data
Right 1024447012 7:49492488-49492510 TTGAGTTTATTCTCTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024447005 Original CRISPR TAATCAACCCCAAGTGGGTT AGG (reversed) Intergenic
No off target data available for this crispr