ID: 1024447006

View in Genome Browser
Species Human (GRCh38)
Location 7:49492444-49492466
Sequence CGTTATAATCAACCCCAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024447006_1024447012 21 Left 1024447006 7:49492444-49492466 CCCACTTGGGGTTGATTATAACG No data
Right 1024447012 7:49492488-49492510 TTGAGTTTATTCTCTTGCCAGGG No data
1024447006_1024447013 24 Left 1024447006 7:49492444-49492466 CCCACTTGGGGTTGATTATAACG No data
Right 1024447013 7:49492491-49492513 AGTTTATTCTCTTGCCAGGGTGG No data
1024447006_1024447011 20 Left 1024447006 7:49492444-49492466 CCCACTTGGGGTTGATTATAACG No data
Right 1024447011 7:49492487-49492509 GTTGAGTTTATTCTCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024447006 Original CRISPR CGTTATAATCAACCCCAAGT GGG (reversed) Intergenic
No off target data available for this crispr