ID: 1024447007

View in Genome Browser
Species Human (GRCh38)
Location 7:49492445-49492467
Sequence CCGTTATAATCAACCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024447007_1024447012 20 Left 1024447007 7:49492445-49492467 CCACTTGGGGTTGATTATAACGG No data
Right 1024447012 7:49492488-49492510 TTGAGTTTATTCTCTTGCCAGGG No data
1024447007_1024447011 19 Left 1024447007 7:49492445-49492467 CCACTTGGGGTTGATTATAACGG No data
Right 1024447011 7:49492487-49492509 GTTGAGTTTATTCTCTTGCCAGG No data
1024447007_1024447013 23 Left 1024447007 7:49492445-49492467 CCACTTGGGGTTGATTATAACGG No data
Right 1024447013 7:49492491-49492513 AGTTTATTCTCTTGCCAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024447007 Original CRISPR CCGTTATAATCAACCCCAAG TGG (reversed) Intergenic
No off target data available for this crispr