ID: 1024447010

View in Genome Browser
Species Human (GRCh38)
Location 7:49492452-49492474
Sequence GGGTTGATTATAACGGGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024447004_1024447010 -9 Left 1024447004 7:49492438-49492460 CCCTAACCCACTTGGGGTTGATT No data
Right 1024447010 7:49492452-49492474 GGGTTGATTATAACGGGCTTTGG No data
1024447005_1024447010 -10 Left 1024447005 7:49492439-49492461 CCTAACCCACTTGGGGTTGATTA No data
Right 1024447010 7:49492452-49492474 GGGTTGATTATAACGGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024447010 Original CRISPR GGGTTGATTATAACGGGCTT TGG Intergenic
No off target data available for this crispr