ID: 1024447011

View in Genome Browser
Species Human (GRCh38)
Location 7:49492487-49492509
Sequence GTTGAGTTTATTCTCTTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024447007_1024447011 19 Left 1024447007 7:49492445-49492467 CCACTTGGGGTTGATTATAACGG No data
Right 1024447011 7:49492487-49492509 GTTGAGTTTATTCTCTTGCCAGG No data
1024447004_1024447011 26 Left 1024447004 7:49492438-49492460 CCCTAACCCACTTGGGGTTGATT No data
Right 1024447011 7:49492487-49492509 GTTGAGTTTATTCTCTTGCCAGG No data
1024447006_1024447011 20 Left 1024447006 7:49492444-49492466 CCCACTTGGGGTTGATTATAACG No data
Right 1024447011 7:49492487-49492509 GTTGAGTTTATTCTCTTGCCAGG No data
1024447005_1024447011 25 Left 1024447005 7:49492439-49492461 CCTAACCCACTTGGGGTTGATTA No data
Right 1024447011 7:49492487-49492509 GTTGAGTTTATTCTCTTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024447011 Original CRISPR GTTGAGTTTATTCTCTTGCC AGG Intergenic
No off target data available for this crispr