ID: 1024447012

View in Genome Browser
Species Human (GRCh38)
Location 7:49492488-49492510
Sequence TTGAGTTTATTCTCTTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024447005_1024447012 26 Left 1024447005 7:49492439-49492461 CCTAACCCACTTGGGGTTGATTA No data
Right 1024447012 7:49492488-49492510 TTGAGTTTATTCTCTTGCCAGGG No data
1024447006_1024447012 21 Left 1024447006 7:49492444-49492466 CCCACTTGGGGTTGATTATAACG No data
Right 1024447012 7:49492488-49492510 TTGAGTTTATTCTCTTGCCAGGG No data
1024447007_1024447012 20 Left 1024447007 7:49492445-49492467 CCACTTGGGGTTGATTATAACGG No data
Right 1024447012 7:49492488-49492510 TTGAGTTTATTCTCTTGCCAGGG No data
1024447004_1024447012 27 Left 1024447004 7:49492438-49492460 CCCTAACCCACTTGGGGTTGATT No data
Right 1024447012 7:49492488-49492510 TTGAGTTTATTCTCTTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024447012 Original CRISPR TTGAGTTTATTCTCTTGCCA GGG Intergenic
No off target data available for this crispr