ID: 1024447988

View in Genome Browser
Species Human (GRCh38)
Location 7:49503965-49503987
Sequence CAGCAGCTCTGTGGGTATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024447988_1024447996 24 Left 1024447988 7:49503965-49503987 CCACTATACCCACAGAGCTGCTG No data
Right 1024447996 7:49504012-49504034 ACGTAAGTTTTATTTGCAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024447988 Original CRISPR CAGCAGCTCTGTGGGTATAG TGG (reversed) Intergenic
No off target data available for this crispr