ID: 1024448595

View in Genome Browser
Species Human (GRCh38)
Location 7:49512360-49512382
Sequence CTGCTGGCCTTGAAGAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024448595_1024448601 8 Left 1024448595 7:49512360-49512382 CCTTATTTCTTCAAGGCCAGCAG No data
Right 1024448601 7:49512391-49512413 CTCACTATAATCTGCTAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024448595 Original CRISPR CTGCTGGCCTTGAAGAAATA AGG (reversed) Intergenic
No off target data available for this crispr