ID: 1024454638

View in Genome Browser
Species Human (GRCh38)
Location 7:49589896-49589918
Sequence CAGTGGAGATGTAGAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1024454635_1024454638 20 Left 1024454635 7:49589853-49589875 CCATTAGGATGGCTACTATCAAA 0: 60
1: 252
2: 493
3: 894
4: 1498
Right 1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG No data
1024454634_1024454638 27 Left 1024454634 7:49589846-49589868 CCTCTCACCATTAGGATGGCTAC No data
Right 1024454638 7:49589896-49589918 CAGTGGAGATGTAGAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1024454638 Original CRISPR CAGTGGAGATGTAGAGAAAT TGG Intergenic
No off target data available for this crispr